Week 6 — Genetic Circuits Part I: Assembly Technologies
Part A: DNA Assembly:
- What are some components in the Phusion High-Fidelity PCR Master Mix and what is their purpose?
- The Phusion Master Mix is designed for high accuracy and speed. It consists of:
- Phusion DNA Polymeraase: A pyrococcus like enzyme fused to a processivity-enhancing domain. Its purpose is to catalyze DNA synthesis with extremely high fidelity (50x higher than Taq) and speed.
- dNTPs (Deoxynucleotide Triphosphates): The building blocks (dATP, dCTP, dGTP, dTTP) used by the polymerase to synthesise the new strand.
- Reaction Buffer: This maintains the ideal pH and ionic strength. These have been optimised for a long range of AT and GC content and includes MgCl2 (cofactor for the DNA polymerase)
What are some factors that determine primer annealing temperature during PCR? The Ta (Annealing temperature) is critical for ensuring primers bind specifically to the target DNA
- Melting temperature (Tm): Ta is ususally set 3-5 degree C below the Tm
- Primer length and sequence: Longer primers and those with higher GC content have more hydrogen bonds and require a higher Ta
- Salt Conc: the concentration of monovalent cations (like K+) and divalent cations like Mg2+ in the bugger stabilizes te DNA duplex affecting the Tm
PCR vs Restriction Enzyme Digest
- Both methods create linear DNA, but thet serve differnt roles:
Feature PCR (Polymerase Chain Reaction) Restriction Enzyme Digest Mechanism De novo synthesis/amplification of a specific region using primers. Enzymatic “cutting” of existing DNA at specific recognition sites. Flexibility Extremely high; you can amplify any sequence and add “tails” (like Gibson overlaps). Limited to where specific restriction sites already exist in the DNA. Fidelity Depends on the polymerase; high-fidelity enzymes (Phusion) are needed to avoid mutations. Very high; you are simply cutting existing, usually verified, DNA. When to Use Best for generating inserts from genomic DNA or adding specific sequences/overlaps to ends. Best for linearizing a circular plasmid backbone or “snapping” out a known part from a carrier. Ensuring compatibility for gibson assembly To make DNA “Gibson-ready”, we must ensure:
- Overlapping Ends: Each adjacent fragment must share 15-40 bp of homologous sequence at their ends. This is typically achieved by adding these sequences as “tails” on our PCR primers.
- Purification: PCR products and digests must be purified using gel extraction or column cleanup to remove the original template DNA, primers and enzymes (like 5’ -> 3’ exonuclease) that could interfere with the reaction.
- Correct Tm of overlaps: The overlapping regions should ideally have a Tm > 48 C to ensure they anneal properly at the isothermal reaction temperature (50 C)
How Plasmid DNA enters E.coli During Heat shock transformation:
- Cells are fiirst treated with calcium chloride (CaCl2). The Ca2+ ions neutralise the negative charges of both the DNA and the cell membrane, allowing the DNA to move close to the surface.
- Moving the cells from ice at 0C to 42 C creates a thermal imbalance that increases membrane fluidity and creates temporary pores in the cell membrane.
- The plasmid is then pulled into the cell through these pores potentially diven by the change un membrane motential and simple diffusion.
Alternative method: Golden Gate Assembly
- Explanation: not as flexible as gibson assembly because it uses restriction enzymes that cut at specific sites.
Pre-lab: Primer Design for gibson assembly:
Acropora millepora chromoprotein (amilCP) variants and Bases:
| Color variant | Codon | Amino Acid Change |
|---|---|---|
| Original | TGTCAG | (Wild Type Cys - Gln ) |
| Orange | ACTGCT | Thr - Ala |
| Blue (aeBlue style) | CAGTAC | Gln - Tyr |
| Pink | TACTGG | Tyr - Trp |
Primers
1. Universal Forward Primer:
This primer is designed to facilitate the seamless assembly of the genetic construct into the destination vector. Sequence B (5’ -cacatccccctttcgccag -3’) serves as the homology tail derived from the pUC19 plasmid, providing the 19bp overlap required for the gibson exonuclease to “chew back” and join the fragments. Sequence A (5’-gaattcggtctctatatgcaggtg-3’) is the annealing segment that specifically targets the mUAV backbone. This 3’ segment has been optimized for a melting temperature of 55.1 C ensuring high fidelity during the PCR amplification step.
- [Sequence B] + [Sequence A]
- 5’ - [cacatccccctttcgccag] + [gaattcggtctctatatgcaggtg] - 3'
2. Universal Reverse Primer:
- 5’ ctgtggtgataaaatatcccaag 3
3. Color Forward Primer:
- Part A(18-24 bp) before the mutation + Part B (mutation site) + Part C( 18-24 bp after the mutation site )
- Orange:
cttgggatattttatcaccacagACTGCTtacggaagcataccattc - Blue :
cttgggatattttatcaccacagCAGTACtacggaagcataccattc - pINK :
cttgggatattttatcaccacagTACTGGtacggaagcataccattc
4. Color Reverse Primer:
5’ - [gtcgggaaacctgtcgtgccag] + [gcagggtctcaatatgcaggtg] - 3’
- mUAV region after terminator:
gcagggtctcaatatgcaggtg(Binds to the end of the backbone). - pUC10 reverse compliment :
gtcgggaaacctgtcgtgccag(Homology for the downstream junction) - Full Primer Sequence:
gtcgggaaacctgtcgtgccaggcagggtctcaatatgcaggtg
- Full Primer Sequence: