V2 Design - Individual Final Project

cover_image cover_image

Project Proposal V2: A Cell-Free Toehold Switch Biosensor with Split-sfGFP Readout for Rapid Detection of HPV16

1. Abstract

Human papillomavirus type 16 (HPV16) is the leading etiological agent of cervical cancer. Current diagnostics require laboratory infrastructure unavailable in many resource-limited settings. DermLogic v2 is a fully cell-free, paper-based diagnostic platform that couples programmable toehold switch riboregulators with a split-sfGFP AND-gate to detect HPV16 L1 and E6 mRNA with single-nucleotide specificity. By splitting sfGFP at the beta-strand 7/8 boundary (residues 157/158), fluorescence reconstitution occurs only when both viral targets are present. This design resolves the logic and thermodynamic flaws of V1, providing a bench-ready, high-specificity diagnostic and integrated antisense E6 therapeutic module.


2. Background and Significance

2.1 HPV16 and the Global Burden

HPV16 accounts for approximately 50–60% of cervical cancer cases worldwide. The early proteins E6 and E7 are primary oncogenic drivers, making their mRNAs ideal molecular targets. There is an urgent need for instrument-free, field-deployable diagnostics that can bypass cold-chain requirements.

Note on Specificity: While the initial week 1 idea wanted to target common skin warts that are caused by “low-risk” HPV types (e.g., HPV1, 2), DermLogic v2 is specifically engineered for HPV16. This high-risk genotype was selected due to its primary role in cervical oncogenesis and the extensive availability of genomic data in existing literature, allowing for the design of highly validated, single-nucleotide-specific toehold switches.

2.2 Split-sfGFP as a Rigorous Logic Gate

In V2, we transition from full-length reporters to a split-protein complementation architecture. Reconstituting sfGFP from two fragments (sfGFP-N 1-157 and sfGFP-C 158-238) provides a “hard” molecular AND-gate. This ensures that signal generation is biophysically impossible unless both viral triggers (L1 and E6) are present, effectively eliminating the “leaky” false positives common in single-channel or dual-color systems.


3. Specific Aims

  • Aim 1: Molecular Logic Validation. Synthesize a split-sfGFP AND-gate using optimized toehold switches targeting HPV16 L1 and E6.
  • Aim 2: Diagnostic Sensitivity. Establish the limit of detection (LoD) in a lyophilized, paper-based format.
  • Aim 3: Therapeutic Integration. Characterize the stability of the 3’-fused antisense E6 RNA co-transcribed with the diagnostic reporter.

4. Experimental Design & Workflow

The validation of the DermLogic v2 system follows a 15-step protocol:

  1. DNA Synthesis: Order Insert A (719 nt) and Insert B (382 nt) in pTwist Amp High Copy backbones.
  2. Trigger Prep: Produce RNA triggers (L1 and E6) via T7 in vitro transcription.
  3. CFPS Assembly: Prepare NEB PURExpress reactions.
  4. Logic Matrix: Test four conditions: (-/-), (L1+/-), (- /E6+), and (L1+/E6+).
  5. Kinetics: Measure sfGFP signal (Ex 485nm / Em 507nm) at 37°C for 120 minutes.
  6. Therapeutic Validation: Perform Urea-PAGE to confirm the presence of the 116 nt antisense/scaffold band.
  7. Field Simulation: Lyophilize reactions onto nitrocellulose paper and test rehydration performance.

5. Technical Validation & Thermodynamics

Specificity (BLASTn)

Triggers were queried against the Homo sapiens transcriptome (taxid:9606) using blastn-short. Results showed no significant similarity, confirming the design is orthogonal to the human host.

Thermodynamic Stability (ViennaRNA)

ChannelTarget RegionMFE (kcal/mol)Toehold State
A (L1)nt 6227-6250-18.30100% Unpaired
B (E6)nt 7577-7601-24.10100% Unpaired

6. Validated Construct Sequences

Insert A (Channel A: L1 → sfGFP-N + Antisense)

Description: Targets L1; expresses sfGFP residues 1-157 and the E6 antisense therapeutic. taatacgactcactatatgaggtggtgggtgtagcttttcgaacagaggagatcgaaaagctacaggaatgagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtccgtggagagggtgaaggtgatgctacaaacggaaaactcacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactctgacctatggtgttcaatgcttttcccgttatccggatcacatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaagggtattgattttaaagaagatggaaacattcttggacacaaactcgagtacaactttaactcacacaatgtatacatcacggcagacaaacaataagcgcgttcgaacgcgctatactatgcataaatcccgaaaagcaaagtcatatacctcacgtcgcagtaactgttgcttgcagtacacacattctaatattatatcatgtatagttggcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattcc

Insert B (Channel B: E6 → sfGFP-C)

Description: Targets E6; expresses sfGFP residues 158-238 to complete the AND-gate.

taatacgactcactatattacagctgggtttctctacgtgttaacagaggagataacacgtagagaaacggaatgaagaatggaatcaaagctaacttcaaaattcgccacaacgttgaagatggttccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattcc


7. Component Provenance

ComponentSource / ReferenceAccession / ID
T7 PromoterStudier & Moffatt 1986BBa_K731721
Toehold LoopPardee et al. 2016B-series (Cell 165:1255)
sfGFP SplitPédelacq et al. 2006GenBank: KJ541673.2
Antisense E6HPV16 GenomeNC_001526.4 (nt 7207-7306)
TerminatorGentz & Bujard 1985BBa_B0012

8. Proposed Budget

ItemSupplierQuantityEstimated Cost
Clonal Gene ATwist Bioscience1 (719 bp)$180.00
Clonal Gene BTwist Bioscience1 (382 bp)$120.00
BL21 DE3 LysateGinkgo Bioworks Master Mix)1 Batch$250.00
RNA TriggersIDT2 (10 nmol)$140.00
Total$690.00

9. IDT Ordering Manifest (RNA Triggers)

To validate the logic in Aim 1, synthetic RNA oligonucleotides matching the HPV16 L1 and E6 target regions will be ordered from IDT. These will be resuspended to 100 µM and used as the “Trigger” inputs for the acoustic liquid handler @Ginko.

9.1 Sequence Specifications

ComponentNameSequence (5’ → 3')Target
Trigger ADermLogic_V2_L1GAA AAG CUA CAG GAA UGA GCA AAG GHPV16 L1
Trigger BDermLogic_V2_E6GUA GAG AAA CGG AAU GAA GAA UGG AHPV16 E6

9.2 Order Parameters

  • Format: RNA Oligo (ssRNA)
  • Scale: 100 nmol
  • Purification: RNase-Free HPLC (Required to minimize “leaky” background signal)
  • Processing: Lyophilized in nuclease-free tubes

Built along with the HTGAA Synthetic Biology Project Design Skill v1.1 along with AI tools : Gemini, GPT 5, phylo(biomini lab)