Week 2 HW: DNA Read, Write, & Edit

Part 1: Benchling & In-Silico Gel Art

Using Benchling, I imported the Lambda DNA sequence and simulated restriction enzyme digestions with EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, and SalI. The goal was to design a gel art pattern inspired by Paul Vanouse’s Latent Figure Protocol.

The design depicts a figure in a rocky victory pose with a crying face, using 5 lanes of selected enzyme combinations to form the image.

Full virtual digest — all 7 enzymes (reference):

Gel art design — victory pose with crying face:

The final design uses the following lanes:

• Lane 1: Lambda_NEB - BamHI
• Lane 2: Lambda_NEB - EcoRV
• Lane 3: Lambda_NEB - KpnI
• Lane 4: Lambda_NEB - EcoRV
• Lane 5: Lambda_NEB - BamHI

Part 2: Gel Art - Restriction Digests and Gel Electrophoresis

We performed the wet-lab restriction digest and gel electrophoresis experiment designed in Part 1, following the Gel Art protocol. Photos of the gel were taken and will be uploaded shortly.

In progress — wet lab gel photos to be uploaded from Discord.

Part 3: DNA Design Challenge

3.1 Protein of Interest

I selected beta-casein (Bos taurus), a milk protein. Accession: UniProt P02666

3.2 Reverse Translation

The protein sequence was reverse translated to DNA using SMS2 Reverse Translate:

atgaaagtgctgattctggcgtgcctggtggcgctggcgctggcgcgcgaactggaagaa
ctgaacgtgccgggcgaaattgtggaaagcctgagcagcagcgaagaaagcattacccgc
attaacaaaaaaattgaaaaatttcagagcgaagaacagcagcagaccgaagatgaactg
caggataaaattcatccgtttgcgcagacccagagcctggtgtatccgtttccgggcccg
attccgaacagcctgccgcagaacattccgccgctgacccagaccccggtggtggtgccg
ccgtttctgcagccggaagtgatgggcgtgagcaaagtgaaagaagcgatggcgccgaaa
cataaagaaatgccgtttccgaaatatccggtggaaccgtttaccgaaagccagagcctg
accctgaccgatgtggaaaacctgcatctgccgctgccgctgctgcagagctggatgcat
cagccgcatcagccgctgccgccgaccgtgatgtttccgccgcagagcgtgctgagcctg
agccagagcaaagtgctgccggtgccgcagaaagcggtgccgtatccgcagcgcgatatg
ccgattcaggcgtttctgctgtatcaggaaccggtgctgggcccggtgcgcggcccgttt
ccgattattgtg

3.3 Codon Optimization

The reverse translated sequence was codon optimized for E. coli expression using VectorBuilder Codon Optimization:

ATGAAAGTGCTGATTCTGGCATGCCTGGTGGCGCTGGCGCTGGCACGTGAACTGGAAGAACTGAATGTTCCGGGCGAAATTGTGGAAAGCCTGAGCAGCAGCGAAGAAAGCATTACCCGCATTAATAAAAAAATTGAAAAATTTCAGAGCGAAGAACAGCAGCAGACCGAAGATGAACTGCAGGATAAAATTCATCCGTTTGCGCAGACCCAGAGCCTGGTGTACCCGTTTCCGGGCCCGATTCCGAACAGCCTGCCGCAGAACATTCCGCCGCTGACCCAGACCCCGGTGGTGGTGCCGCCGTTTCTGCAGCCGGAAGTGATGGGCGTCAGCAAAGTGAAAGAAGCCATGGCGCCGAAACACAAAGAAATGCCGTTTCCGAAATATCCGGTGGAACCGTTTACCGAATCACAGTCACTGACCCTGACCGATGTGGAAAACCTGCACCTGCCGCTGCCGCTGCTGCAGTCGTGGATGCACCAGCCGCACCAGCCGCTGCCGCCGACCGTCATGTTTCCGCCGCAGAGCGTGCTGAGCCTGTCACAGAGCAAAGTGCTGCCGGTGCCGCAGAAAGCGGTGCCGTATCCGCAGCGTGACATGCCGATTCAGGCGTTCCTGCTGTATCAGGAACCGGTGCTGGGCCCGGTTCGTGGCCCGTTTCCGATTATTGTG

Codon optimization translates a DNA sequence to match the codon preferences of a target organism. Beta-casein is naturally expressed in bovines (Bos taurus), but here I optimized for E. coli since it is a different organism with different preferred codon usage. By remapping the codons, we maximize translational efficiency and protein yield in the new host.

3.4 Protein Production Technologies

With the codon-optimized sequence, the protein can be produced via two approaches:

• Cell-dependent: The codon-optimized DNA is introduced into E. coli cells (e.g. via a plasmid). The cell’s own transcription and translation machinery reads the sequence and produces the protein.
• Cell-free: The necessary cellular components (ribosomes, tRNA, polymerases, etc.) are extracted and used in vitro to transcribe and translate the DNA into protein, without needing a living cell.

3.5 Transcriptional Protein Diversity (Optional)

Skipped.

Part 4: Twist DNA Synthesis Order

Following the Twist tutorial, I built an expression cassette in Benchling containing a promoter, RBS, start codon, codon-optimized coding sequence, 7x His tag, stop codon, and terminator. The linear sequence was then uploaded to Twist to prepare a clonal gene order, and the resulting construct was imported back into Benchling to verify the plasmid design.

Step 1 — Linear expression cassette in Benchling (924 bp):

Step 2 — Uploaded to Twist (clonal gene order):

Step 3 — Final circular plasmid verified in Benchling (3145 bp, pTwist Amp High Copy):

Part 5: DNA Read/Write/Edit

5.1 DNA Read

In progress.

5.2 DNA Write

In progress.

5.3 DNA Edit

In progress.