Labs

Lab writeups:

  • Week 1 Lab: Pipetting

  • Week 6 Lab: Gibson assembly

    Week 6 — Genetic Circuits Part I Protocol: DNA Assembly What are some components in the Phusion High-Fidelity PCR Master Mix, and what is their purpose? The Phusion High-Fidelity PCR Master Mix contains several components required for efficient and accurate DNA amplification. The key components are: Phusion DNA Polymerase: A high-fidelity thermostable polymerase derived from Pyrococcus. It has proofreading (3’→5’ exonuclease) activity, which reduces the error rate during DNA synthesis

Subsections of Labs

Week 1 Lab: Pipetting

cover image cover image

Week 6 Lab: Gibson assembly

Week 6 — Genetic Circuits Part I

w6h3 w6h3

Protocol: DNA Assembly

  1. What are some components in the Phusion High-Fidelity PCR Master Mix, and what is their purpose?

The Phusion High-Fidelity PCR Master Mix contains several components required for efficient and accurate DNA amplification. The key components are:

  • Phusion DNA Polymerase: A high-fidelity thermostable polymerase derived from Pyrococcus. It has proofreading (3’→5’ exonuclease) activity, which reduces the error rate during DNA synthesis

  • dNTPs (deoxynucleotide triphosphates): These are the building blocks used by the polymerase to synthesize the new DNA strand

  • Reaction buffer: Provides optimal ionic strength and pH for polymerase activity. It usually contains Mg²⁺, which is required as a cofactor for DNA polymerase

  • MgCl₂: Magnesium ions stabilize primer-template interactions and are essential for the catalytic activity of the polymerase

  • Stabilizers and additives: These help maintain enzyme stability and improve amplification efficiency

The master mix in PCR is prepared to simplify the reaction setup and ensure consistency across multiple reactions. Instead of adding each component separately, the master mix contains the essential reagents required for DNA amplification, such as the polymerase, buffer, Mg²⁺ ions, and dNTPs.

In practice, the total master mix volume is calculated based on the number of reactions to be performed, and it is recommended to prepare additional volume (usually enough for one or two extra reactions) to account for a negative control and possible pipetting errors.

In general, using a master mix also helps reduce variability between reactions and ensures high specificity and low mutation rates during amplification when using high-fidelity enzymes such as Phusion polymerase.

  1. What are some factors that determine primer annealing temperature during PCR?

The primer annealing temperature (Ta) is critical for PCR specificity and efficiency. Some factors that determine the annealing temperature include:

  1. Primer melting temperature (Tm): The annealing temperature is typically 3–5°C below the primer Tm

  2. Primer length: Longer primers generally have higher melting temperatures

  3. GC content: Primers with higher GC content have stronger hydrogen bonding and therefore higher Tm

  4. Primer sequence composition: Runs of GC or secondary structures can affect annealing behavior

  5. Salt concentration in the buffer: Ionic conditions influence primer-template hybridization

  6. Template complexity: Complex templates or repetitive regions may require optimized annealing temperatures

(Rychlik et al., 1990)

The important part is choosing the correct annealing temperature, which helps ensure that primers bind specifically to the intended target sequence. As well, remember the principal steps of PCR in Figure 1.

w6labpcr w6labpcr

Figure 1. MiniPCR graphic ‘Depiction of one PCR cycle.’

  1. There are two methods from this class that create linear fragments of DNA: PCR, and restriction enzyme digests. Compare and contrast these two methods, both in terms of protocol as well as when one may be preferable to use over the other.

Both PCR amplification and restriction enzyme digestion can generate linear DNA fragments, but they differ significantly in methodology and application. In Table 1, the differences between PCR and restriction enzyme digest are summarized.

Table 1. Comparison of PCR vs. Restriction enzyme digest

CategoryPCRRestriction Enzyme Digest
PrincipleDNA amplification using primers and polymeraseCutting DNA using sequence-specific enzymes
DNA requirementSmall amount of template DNARequires plasmid or DNA containing restriction sites
SpecificityDetermined by primer designDetermined by enzyme recognition sequences
OutputAmplified fragment of specific lengthLinearized DNA or defined fragments
FlexibilityCan add overhangs or modifications through primersLimited to existing restriction sites

When is PCR preferable?

  • When amplifying a specific gene or fragment
  • When introducing mutations or overhangs
  • When restriction sites are not present

When are restriction enzymes preferable?

  • When cutting plasmids or large DNA constructs
  • When working with known restriction maps
  • When cloning using classical restriction-ligation methods

PCR offers greater flexibility, while restriction enzyme digestion provides precise cleavage at defined sequences. Also, PCR amplifies many copy of the DNA or genetic material, while restriction enzymes cut a specific region as mentioned before.

  1. How can you ensure that the DNA sequences that you have digested and PCR-ed will be appropriate for Gibson cloning?

To ensure that the DNA sequences that you have digested and PCR-ed will be appropriate for Gibson Assembly, DNA fragments must contain overlapping homologous regions.

Table 2. Requirements for Gibson Assembly

To ensure compatibility:
Design PCR primers with 20–40 bp overlaps matching adjacent fragments.
Verify sequences in silico using tools such as Benchling.
Ensure fragments are linear and free of secondary structures.
Confirm correct fragment size via gel electrophoresis.
Remove template plasmid contamination if necessary (e.g., DpnI digestion).

Then, those overlapping sequences allow the Gibson reaction enzymes to:

  1. Generate single-stranded overlaps
  2. Anneal complementary regions
  3. Fill gaps and ligate the fragments.

Extra: Thermofisher graphic:

w6thermogibbson w6thermogibbson

Figure 2. Gibson Assembly 101: Expert Cloning Tips You Need to Know (thermofisher)

  1. How does the plasmid DNA enter the E. coli cells during transformation?

During transformation, plasmid DNA enters E. coli cells that have been made competent, the most common methods are: Chemical transformation & Electroporation.

Table 3. Chemical transformation vs. Electroporation

Chemical transformationElectroporation
Cells are treated with CaCl₂, which neutralizes negative charges on DNA and the cell membraneCells are washed to remove salts
DNA is added to the competent cellsA high-voltage electric pulse creates temporary pores in the membrane
A heat shock (~42°C) briefly disrupts the membraneDNA enters through these pores
DNA enters the cell through transient poresCells recover and replicate the plasmid

(Liu et al., 2018; Asif et al., 2017)

After transformation, cells are plated on selective media containing antibiotics to identify successful transformants.

  1. Describe another assembly method in detail (such as Golden Gate Assembly):

a. Explain the other method in 5 - 7 sentences plus diagrams (either handmade or online).

Golden Gate Assembly is a molecular cloning technique that allows the simultaneous assembly of multiple DNA fragments in a single reaction. The method uses Type IIS restriction enzymes, such as BsaI, which cut DNA outside of their recognition sequence to generate customizable overhangs. These overhangs allow DNA fragments to ligate together in a specific and predetermined order. During the reaction, the restriction enzyme first digests the DNA fragments, generating compatible sticky ends, and DNA ligase then joins the fragments together. Because the recognition sites are removed during digestion, the final construct does not contain unwanted restriction sequences, resulting in scarless cloning. This technique is widely used in synthetic biology because it enables efficient multi-fragment assembly in a single tube (Bird et al., 2018).

Diagram:

flowchart LR
    A[Fragment A] --> D[BsaI digestion]
    B[Fragment B] --> D
    C[Fragment C] --> D

    D --> E[Sticky overhangs]
    E --> F[Ligation]

    F --> G[Final plasmid<br>A-B-C]

b. Model this assembly method with Benchling or Asimov Kernel!

Assembly Method with Benchling

For this activity, the Golden Gate Assembly method was modeled using Benchling. The project folder used for this exercise can be accessed through the following link:

Benchling notebook:

https://benchling.com/s/etr-kngPcBZoUEyYeCgTCDPg?m=slm-Da5SoGLKMli7AVX0fcKa

To perform the assembly, the plasmid pUC19 was selected as the backbone sequence. The full plasmid sequence was obtained from Addgene, which provides verified plasmid maps and DNA sequences commonly used in molecular biology. Sequence

pUC19 plasmid full sequence:

>Addgene_NGS_Result
GAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACT

To demonstrate the assembly process, a small synthetic DNA fragment representing a peptide-coding sequence was created as an example insert.

Small_Peptide_insert:

GGTCTCAATGATGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTTAAGCTTGAGACC

This fragment includes recognition sites for the Type IIS restriction enzyme BsaI, which is required for Golden Gate Assembly. And its structure has a short alanine-rich peptide used as a synthetic example insert. Golden Gate Assembly uses Type IIS restriction enzymes that cut outside their recognition sequence, allowing the creation of custom overhangs. These overhangs guide the directional ligation of DNA fragments, enabling multiple pieces of DNA to be assembled in a single reaction.

In Benchling, the pUC19 backbone and the synthetic insert were added to the assembly workspace. The Golden Gate cloning method was selected, and BsaI was defined as the restriction enzyme. The insert fragment was generated using a primer pair to simulate PCR amplification, which allows the introduction of compatible overhangs for the assembly.

After defining the fragments, Benchling automatically generated compatible sticky ends between the backbone and the insert. Once the fragments were validated, the assembly was finalized to generate the construct pUC19_backbone–small_peptide_insert.

Final Golden Gate Assembly plasmid:

plasmid plasmid

Figure 3. pUC19_backbone–small_peptide_insert by Golden Gate Assembly method

Tutorial for assembly method with Benchling

Additionally, I created a document that shows the process I used to create the plasmid.

Click here to download the PDF file: w6labpdf

Next part of the homework is at: Homework- Week 6 section

References & sources:

Asif, A., Mohsin, H., Tanvir, R., & Rehman, Y. (2017). Revisiting the Mechanisms Involved in Calcium Chloride Induced Bacterial Transformation. Frontiers in microbiology, 8, 2169. https://doi.org/10.3389/fmicb.2017.02169 Open Access

Bird, J. E., Marles-Wright, J., & Giachino, A. (2022). A User’s Guide to Golden Gate Cloning Methods and Standards. ACS synthetic biology, 11(11), 3551–3563. https://doi.org/10.1021/acssynbio.2c00355 Open Access

Gibson, D. G., Young, L., Chuang, R. Y., Venter, J. C., Hutchison, C. A., 3rd, & Smith, H. O. (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature methods, 6(5), 343–345. https://doi.org/10.1038/nmeth.1318 Open Access

Liu, J., Chang, W., Pan, L., Liu, X., Su, L., Zhang, W., Li, Q., & Zheng, Y. (2018). An Improved Method of Preparing High Efficiency Transformation Escherichia coli with Both Plasmids and Larger DNA Fragments. Indian journal of microbiology, 58(4), 448–456. https://doi.org/10.1007/s12088-018-0743-z Open Access

Rychlik, W., Spencer, W. J., & Rhoads, R. E. (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic acids research, 18(21), 6409–6412. https://doi.org/10.1093/nar/18.21.6409 Open Access

Sources:

Phusion, webpage info: https://www.neb.com/en/products/m0531-phusion-high-fidelity-pcr-master-mix-with-hf-buffer?srsltid=AfmBOopLTuidkTgdekk3Q9oLaFWk-2M3fbxF2rDrw8HETkYpljeOGSOH

Figure 1: https://www.minipcr.com/pcr/

Figure 2: https://www.thermofisher.com/blog/life-in-the-lab/gibson-assembly-101-expert-cloning-tips-you-need-to-know/

Extra Material

Construct Table file CVS –> To download, click here: Table