🧬 Week 02 - DNA Read, Write & Edit

Global Listener - Anastasia Ntavou
Athens, Greece
Project Context: Mycelium Surfboard (Ganoderma lucidum engineering)

Part 0: Gel Electrophoresis Basics

Watched recitation video. Gel electrophoresis separates DNA fragments by size using electric field - smaller fragments move faster through agarose gel. Visualized Lambda DNA digest patterns.

Part 1: Benchling Gel Art (In-silico)

  • Imported Lambda DNA sequence in Benchling (free account).
  • Simulated restriction digests: EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI.
  • Created surf wave pattern by arranging fragment bands artistically. Benchling project: View sequence

Part 3: DNA Design Challenge

3.1 Protein Choice
Selected Hydrophobin SC16 (Schizophyllum commune, UniProt D8QCG9, PDB 7S7S) for mycelium surfboard. Class I hydrophobin that self-assembles into amphipathic rodlet films at hydrophobic interfaces — ideal for waterproofing Ganoderma lucidum mycelium composites.

3.2 Reverse Translation
Converted protein to DNA using standard genetic code:
ATGATCAGAACGTTCTCGTCGATCGCCGTGGCCGCCGCCTTGGTGGTGTCCGTGGGCGCTCAGGCCGAGGTTTCGTCGGCAGCTGCCTCCGCGGCACCGGCAGCTCCTACAGCAGCGCCTGTGGCGCCG

3.3 Codon Optimization
Optimized for Ganoderma lucidum using IDT codon tool (fungal bias). Improved tRNA matching for higher expression:
ATGATTCGTACGTTCAGCAGCGCCATCGCCGTGGCCGCCGCCCTGGTGGTGTCGGTGGGCGCGCAGGCCGAGGTCTCGTCGGCAGCTCGCCTCCGCGGCACCGCGCAGCTCCTACAGCAGCGCGGTGGTGCC

3.4 DNA → Protein
DNA → RNA polymerase transcription → mRNA (T→U) → ribosome translation with tRNAs → protein chain. Cell-free option: PureExtract kit.

3.5 Central Dogma Diagram
Central Dogma Central Dogma

Part 4: Twist DNA Synthesis Order

Built expression cassette in Benchling:
J23100 promoter + B0034 RBS + ATG + optimized hydrophobin + 6xHis tag + TAA + B0015 terminator

Twist Bioscience quote: pTwist Amp vector, 350bp insert = ~$35 ($0.09/bp).
Twist Bioscience Quote Twist Bioscience Quote

Part 5: DNA Read, Write & Edit

5.1 DNA Read

What: Sequence the native Ganoderma lucidum genome to identify endogenous hydrophobin variants and laccase isoforms relevant to the mycelium surfboard project.

Technology: Illumina NovaSeq (second-generation sequencing)

  • Why: High throughput, low cost per base, well-established bioinformatics pipelines for fungal genomes
  • Input: High molecular weight genomic DNA extracted from G. lucidum mycelium; fragmented to ~300-500bp; Illumina adapters ligated; PCR amplification
  • Essential steps: Fragment DNA → ligate adapters → bridge amplification on flow cell → sequencing-by-synthesis (fluorescent dNTPs) → base calling
  • Output: FASTQ files; assembled genome compared to reference G. lucidum genome (GenBank AGFW00000000)
  • Generation: Second-generation (Next-Generation Sequencing)

5.2 DNA Write

What: Synthesize the optimized SC16 hydrophobin expression cassette for insertion into G. lucidum.

Sequence: SC16 hydrophobin codon-optimized for G. lucidum (IDT optimization, ~342bp) in pTwist Amp vector with GPD promoter and TrpC terminator.

Technology: Twist Bioscience chemical gene synthesis

  • Why: Accurate synthesis up to 5kb, scarless, no cloning artifacts
  • Essential steps: Oligo synthesis (phosphoramidite chemistry) → error correction → gene assembly → cloning into vector → sequence verification
  • Limitations: Max ~5kb per fragment; $0.09/bp; 10-15 business day turnaround

5.3 DNA Edit

What: Engineer G. lucidum to express SC16 hydrophobin and overexpress LAC2 laccase via CRISPR-Cas9 knock-in.

Technology: CRISPR-Cas9 via Agrobacterium-mediated transformation

  • Why: More efficient than protoplast electroporation for filamentous fungi; stable genomic integration
  • Design steps: Design sgRNA targeting safe harbor locus (CRISPOR tool, NGG PAM); codon-optimize Cas9 for G. lucidum; design homology-directed repair (HDR) template with ~500bp homology arms
  • Input: Cas9 RNP + sgRNA + HDR template plasmid; Agrobacterium tumefaciens as delivery vehicle; hygromycin selection (pAN7-1 backbone)
  • Essential steps: Transform Agrobacterium with construct → co-culture with G. lucidum spores → select transformants on hygromycin plates → verify by PCR + sequencing
  • Limitations: Low transformation efficiency in fungi (~1-5%); off-target edits ~1-5%; time-consuming (4-6 weeks)

View Benchling project