Week 02 - DNA Read, Write & Edit

Week 02 Homework: DNA Read, Write & Edit

Global Listener - Anastasia Ntavou
Athens, Greece
Project Context: Mycelium Surfboard (Ganoderma lucidum engineering)

Part 0: Gel Electrophoresis Basics

Watched recitation video. Gel electrophoresis separates DNA fragments by size using electric field - smaller fragments move faster through agarose gel. Visualized Lambda DNA digest patterns.

Part 1: Benchling Gel Art (In-silico)

  • Imported Lambda DNA sequence in Benchling (free account).
  • Simulated restriction digests: EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI.
  • Created surf wave pattern by arranging fragment bands artistically. [Screenshot/ Benchling link coming soon]

Part 3: DNA Design Challenge

3.1 Protein Choice
Selected Hydrophobin (HFB1_ASPFU, UniProt P52746) for mycelium surfboard. Enables fungi to adhere to hydrophobic surfaces/water interfaces - perfect for olive-waste Ganoderma lucidum surfboard substrate.

3.2 Reverse Translation
Converted protein to DNA using standard genetic code:
ATGATCAGAACGTTCTCGTCGATCGCCGTGGCCGCCGCCTTGGTGGTGTCCGTGGGCGCTCAGGCCGAGGTTTCGTCGGCAGCTGCCTCCGCGGCACCGGCAGCTCCTACAGCAGCGCCTGTGGCGCCG

3.3 Codon Optimization
Optimized for Ganoderma lucidum using IDT codon tool (fungal bias). Improved tRNA matching for higher expression:
ATGATTCGTACGTTCAGCAGCGCCATCGCCGTGGCCGCCGCCCTGGTGGTGTCGGTGGGCGCGCAGGCCGAGGTCTCGTCGGCAGCTCGCCTCCGCGGCACCGCGCAGCTCCTACAGCAGCGCGGTGGTGCC

3.4 DNA → Protein
DNA → RNA polymerase transcription → mRNA (T→U) → ribosome translation with tRNAs → protein chain. Cell-free option: PureExtract kit.

3.5 Central Dogma Diagram
[Hand-drawn sketch coming]

Part 4: Twist DNA Synthesis Order

Built expression cassette in Benchling:
J23100 promoter + B0034 RBS + ATG + optimized hydrophobin + 6xHis tag + TAA + B0015 terminator

Twist Bioscience quote: pTwist Amp vector, 350bp insert = ~$35 ($0.09/bp).
[FASTA file / quote screenshot coming]

Part 5: DNA Read/Write/Edit Plans

Read: Sequence native Ganoderma lucidum genome for hydrophobin variants. Illumina NovaSeq - fragment DNA, add adapters, bridge amplification, sequencing-by-synthesis. FASTQ output.

Write: Synthesize optimized hydrophobin cassette. Twist Bioscience - chemical oligo synthesis → gene assembly. Max ~2kb, $0.09/bp.

Edit: Engineer Ganoderma to overexpress hydrophobin. CRISPR-Cas9 - design sgRNA (NGG PAM), electroporate Cas9 RNP into protoplasts. Off-target risk ~1-5%.

Challenges & Learnings

First time using Benchling - struggled with annotation features but tutorials helped. Codon optimization concept clearer now for fungal expression systems.

[Benchling project link coming soon]