🧬 Week 7: Neuromorphic Circuits & Fungal Materials
Part 1: Intracellular Artificial Neural Networks (IANNs)
1. Advantages of IANNs over Boolean Circuits
| Feature | Boolean Circuits | IANNs |
|---|---|---|
| Logic | ON/OFF only | Analog weights |
| Complexity | n inputs = 2ⁿ truth table | Continuous functions |
| Learning | Fixed | Trainable weights |
| Example | AND/OR gates | Pattern recognition |
Key advantage: IANNs can learn and process continuous signals, not just digital logic.
2. Useful IANN Application: Tumor Microenvironment Classifier
Input (X1-X4):
- X1: Hypoxia (HIF-1α levels)
- X2: Lactate concentration
- X3: pH sensor
- X4: Cytokine IL-6
Output: Apoptosis trigger (therapeutic payload release)
Behavior:
- Weighted sum of inputs → activation threshold
- Only tumor microenvironment triggers output
- Normal tissue (low signals) → no activation
Limitations:
- Training in vivo difficult
- Crosstalk between endoribonucleases
- Cell-to-cell variability in weights
3. Multilayer Perceptron Diagram
LAYER 1: [X1 DNA] → Tx → Tl → Csy4-A (endoribonuclease) ↓ cleaves [X2 DNA] → Tx → mRNA-A[hairpin] → Tl → Csy4-B (Layer 1 output)
LAYER 2: [Csy4-B] (from Layer 1) cleaves: ↓ [Y DNA] → Tx → mRNA-Y[hairpin] → Tl → Fluorescent Protein
Key: Layer 1 output (Csy4-B) becomes Layer 2 input.
Part 2: Fungal Materials
1. Existing Fungal Materials
| Material | Use | Advantages | Disadvantages |
|---|---|---|---|
| Mycelium leather | Fashion, upholstery | Biodegradable, fast growth | Lower tensile strength |
| Mycelium foam | Packaging, insulation | Carbon-negative | Moisture sensitive |
| Amadou (Fomes) | Traditional tinder | Fire-resistant | Limited applications |
Advantages: Sustainable, low energy, compostable
Disadvantages: Durability, water resistance, scalability
2. Genetic Engineering Goals
Target: Engineer Ganoderma to produce hydrophobin SC16 for water-resistant mycelium composites.
Why fungi > bacteria:
- Native protein secretion (signal peptides)
- Post-translational modifications (disulfide bonds)
- Large-scale biomass (no fermentation tanks)
- Self-assembling materials (hyphae networks)
Application: Water-resistant mycelium leather with SC16 surface coating.
Part 3: DNA Twist Order - SOD1 Peptide Binder
Draft Aim 1: Therapeutic Peptide for ALS
Design: SOD1 A4V binding peptide RDGEGELLENRR (from Week 5 PepMLM)
Insert Sequence:
ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGA TGGCGCGCGATGGCGAGGGTGAGCTCCTCGAGAACCGCCGCTAGGGATCCGC
Backbone: pET28a (+kanamycin resistance)
Features:
- His6-tag N-terminal
- Thrombin cleavage site
- T7 promoter (IPTG inducible)
Expression: E. coli BL21(DE3)
Benchling Link: View Benchling construct — SOD1 A4V binder