🧬 Week 7: Neuromorphic Circuits & Fungal Materials

Part 1: Intracellular Artificial Neural Networks (IANNs)

1. Advantages of IANNs over Boolean Circuits

FeatureBoolean CircuitsIANNs
LogicON/OFF onlyAnalog weights
Complexityn inputs = 2ⁿ truth tableContinuous functions
LearningFixedTrainable weights
ExampleAND/OR gatesPattern recognition

Key advantage: IANNs can learn and process continuous signals, not just digital logic.

2. Useful IANN Application: Tumor Microenvironment Classifier

Input (X1-X4):

  • X1: Hypoxia (HIF-1α levels)
  • X2: Lactate concentration
  • X3: pH sensor
  • X4: Cytokine IL-6

Output: Apoptosis trigger (therapeutic payload release)

Behavior:

  • Weighted sum of inputs → activation threshold
  • Only tumor microenvironment triggers output
  • Normal tissue (low signals) → no activation

Limitations:

  • Training in vivo difficult
  • Crosstalk between endoribonucleases
  • Cell-to-cell variability in weights

3. Multilayer Perceptron Diagram

LAYER 1: [X1 DNA] → Tx → Tl → Csy4-A (endoribonuclease) ↓ cleaves [X2 DNA] → Tx → mRNA-A[hairpin] → Tl → Csy4-B (Layer 1 output)

LAYER 2: [Csy4-B] (from Layer 1) cleaves: ↓ [Y DNA] → Tx → mRNA-Y[hairpin] → Tl → Fluorescent Protein

Key: Layer 1 output (Csy4-B) becomes Layer 2 input.

Part 2: Fungal Materials

1. Existing Fungal Materials

MaterialUseAdvantagesDisadvantages
Mycelium leatherFashion, upholsteryBiodegradable, fast growthLower tensile strength
Mycelium foamPackaging, insulationCarbon-negativeMoisture sensitive
Amadou (Fomes)Traditional tinderFire-resistantLimited applications

Advantages: Sustainable, low energy, compostable
Disadvantages: Durability, water resistance, scalability

2. Genetic Engineering Goals

Target: Engineer Ganoderma to produce hydrophobin SC16 for water-resistant mycelium composites.

Why fungi > bacteria:

  • Native protein secretion (signal peptides)
  • Post-translational modifications (disulfide bonds)
  • Large-scale biomass (no fermentation tanks)
  • Self-assembling materials (hyphae networks)

Application: Water-resistant mycelium leather with SC16 surface coating.

Part 3: DNA Twist Order - SOD1 Peptide Binder

Draft Aim 1: Therapeutic Peptide for ALS

Design: SOD1 A4V binding peptide RDGEGELLENRR (from Week 5 PepMLM)

Insert Sequence:

ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGA TGGCGCGCGATGGCGAGGGTGAGCTCCTCGAGAACCGCCGCTAGGGATCCGC

Backbone: pET28a (+kanamycin resistance)

Features:

  • His6-tag N-terminal
  • Thrombin cleavage site
  • T7 promoter (IPTG inducible)

Expression: E. coli BL21(DE3)

Benchling Link: View Benchling construct — SOD1 A4V binder