Week 1 HW: Principles and Practices

1. I found myself very interested in the aspect of biosynthesis and engineering fabric-like material from microorganisms. The example shown in the first lecture of jackets made from bacterial cellulose piqued my curiosity in particular because it involves possibly making clothes from sustainable and biodegradable material instead of plastic. As a biology student, this application opened my eyes to a new and exciting path I could take in the future that is independent from medicinal applications. For now, I’m very curious about it. But hopefully, I will be able to make this my final project and get hands on experience in synthesizing such materials.

2. I view biosynthesizing fabric-like materials as an alternative to traditional methods that use plastics/nonbiodegradable materials. The traditional method contributes significantly to pollution and harms the environment. A governance goal would be to ensure that this technology is actually capable of reducing environmental harm when produced for industrial use. A sub goal can be verifying sustainability claims through experimental evidence and making sure the production process is safe for both the ecosystem and the workers. If this field is developed enough to find a way to scale this for industrial use, it could be a real game changer in the fashion industry while lessening environmental risks.

3. Ensuring biosynthesized materials are developed responsibly requires several governance actions that can be implemented by different major actors.

An important, and perhaps a primary, actor would be government and regulatory agencies. These organizations are capable of establishing biosafety rules that require laboratories to safely handle engineered microorganisms used in biofabrication. These rules aim to prevent accidents and protect public safety. These regulations involve creating a standardized process about containment and waste management that institutes must follow to receive licensing. The assumption here is that the companies would comply and strictly enforce the regulations. It could very well fail if the instructions are loosely enforced or, on the contrary, are too strict and restrictive, which might slow the creative process.

The second actor is biotech and fashion companies. These companies can contribute by implementing sustainable production practices as well as providing transparent information about their products. Advertising also plays a major role in how the customers would perceive this new invention. The purpose is for consumers to be aware of what they are purchasing, this can further raise awareness about the existence of a more ecofriendly way of consuming. This governance assumes multiple things; that the companies prioritize ethical responsibilities and that consumers will respond positively to the nature of biosynthesized products. A potential risk is that companies may lean towards misinformation, exaggerating or poorly marketing their products.

The third actor are universities and researchers. Researchers can study and evaluate the true environmental impact of biosynthesized materials; this would provide more concrete evidence that they’re safe for the environment as well as potentially developing a safer version of engineered microorganisms. The purpose is to provide reliable scientific evidence to act as a guide for industrial use. This assumes the willingness to fund the research and provided ethical supervision. A risk may be limited funding given the scale and material this kind of research requires.

   +------------------------+---+---+---+---+---+---+---+---+---+
  |                        |Regulatory|   Biotech   |Researchers|
  |                       |SS  AB  MC   DN  SP  PF   RB EG TR   |
   +------------------------+---+---+---+---+---+---+---+---+---+

  ENHANCE BIOSECURITY
  Prevent incidents       | 1 | 1 | 2 | 2 | 2 | 3 | 2 | 1 | 3 |
  Help respond            | 2 | 2 | 1 | 3 | 2 | 3 | 2 | 2 | 3 |

  FOSTER LAB SAFETY
  Prevent incidents       | 1 | 2 | 2 | 2 | 2 | 3 | 2 | 1 | 2 |
  Help respond            | 2 | 2 | 1 | 3 | 2 | 3 | 2 | 2 | 2 |

  PROTECT ENVIRONMENT
  Prevent incidents       | 1 | 1 | 2 | 1 | 2 | 2 | 2 | 1 | 3 |
  Help respond            | 2 | 2 | 1 | 3 | 2 | 2 | 2 | 2 | 3 |

  OTHER CONSIDERATIONS
  Minimize cost/burden    | 2 | 3 | 2 | 2 | 3 | 1 | 2 | 2 | 1 |
  Feasibility             | 1 | 2 | 1 | 2 | 2 | 1 | 1 | 2 | 1 |
  Not impeding research   | 2 | 3 | 2 | 1 | 2 | 1 | 1 | 2 | 1 |
  Promote constructive    | 2 | 1 | 2 | 1 | 1 | 1 | 1 | 1 | 2 |

Key:

SS = Set safety standards

AB = Approve biomaterials

MC = Monitor companies

DN = Develop new fibers

SP = Scale production

PF = Partner fashion

RB = Research bio processes

EG = Experiment genetics

TR = Train researchers

(sorry, i made my original chart in Word. i couldnt transfer it here and i had trouble inserting an image so i used chatgpt to convert it to text.)

5. Based on the scoring, I would prioritize the actions that must be taken by regulatory agencies and biotech companies. They establish clear biosafety and clarify the environmental impact, all essential to ensuring that biosynthetic fabrics are produced in a safe and responsible manner. Biotech companies develop and scale products is necessary because without industry involvement this technology cannot become easily accessible to the masses. These actions balance creativity, engineering and safety, contributing to the field growth while minimizing environmental risks. a potential trade off is that strict regulations may slow the researching process and increase production costs. and because this is still a developing field, there is no garanty about its long term impact on the enviroment. an ethical concern i found in the topics covered during the lecture would be automating protein monitoring. though it is much faster than humans, it is susceptible to error and biases. governance actions to address this concern maintaining regular human reveiewing to ensure no errors or contamination goes unnoticed.

Week 2 HW: Pre lecture

1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome. How does biology deal with that discrepancy?

response:

The error rate of polymerase is one per million bases. Compared to the human genome which is in total 3.2 GBP, which means approximately 3000 errors per genome. The human body deals with this error through a few ways: 1) polymerase proofreading: this utilizes 3’-5’ exonuclease which splices out the wrong mismatched nucleotide from the 3’ end of the strand. This process happens while the DNA replication is active. 2) Mismatch repair: after DNA is finished replicating, proteins like MutS read the strand for incorrect pairings that have escaped the earlier proofreading. It, similarly, cuts out the incorrect nucleotide before resynthesizing that section.

2. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest?

   The average human gene for a protein is 1036 Bp according to Professor Jacobson. And there are four nucleotides that make up the human genome (A,T,C,G). So, if we want to know all the possible ways we can code for a single gene, we must raise 4 to the power of 1036, which ultimately gives us 10^623 possibilities. There are multiple reasons why not all codes work efficiently to code for certain proteins. Codon bias, for example, entails that rare codon is slower to translate due to a different tRNA availability. Though the tRNA is always there, it might take longer to translate a rare codon which would stagger the process. mRNA can be slower to recognize the start site in the presence of strong secondary structures.

3. What’s the most commonly used method for oligo synthesis currently?

   As described in professor Leproust’s slides, solid phase phosphoramidite oligonucleotide synthesis.

4. Why is it difficult to make oligos longer than 200nt via direct synthesis?

   Because making oligos longer than 200 nt suggests to a large margin of error. The process is already error prone as a single cycle is not at 100% efficiency, this lessens the yield as the sequences get longer. Why cant you make a 2000bp gene via direct oligo synthesis? At this stage of developing oligo synthesis, the current limit is 700 nucleotides.

5. [Using Google & Prof. Church’s slide #4] What are the 10 essential amino acids in all animals and how does this affect your view of the “Lysine Contingency”?

   Lysine, leucine, isoleucine, valine, threonine, methionine, phenylalanine, tryptophan, histidine, arginine. The lysine contingency leverages animals’ reliance on lysine. While it is plausible, given that animals need it for survival. But it is highly unlikely that the dinosaurs (animals) wouldn’t find it available in their environment given how readily available it is in the ecosystem. My biggest issue with this idea is that lysine absence (again, farfetched) would take weeks before the animal dies from it.

Week 2 HW: DNA read and edit

part 1:Create a pattern/image in the style of Paul Vanouse’s Latent Figure Protocol artworks. You might find Ronan’s website a helpful tool for quickly iterating on designs!

part 3: 3.1. Choose your protein.

In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose.

A) for my protein, i chose HPLC-12 which is type III antifreeze protein, found in Ocean pout and eelpot (polar fish) it is only 66 amino acids long. its function is to prevent ice crystals from forming in the blood stream in sub zero temperatures.

the 66 amino acid obtained from Uniprot:

NQASVVANQLIPINTALTLVMMRSEVVTPVGIPAEDIPRLVSMQVNRAVPLGTTLMPDMV KGYPPA

3.2 Reverse Translation

The Central Dogma discussed in class and recitation describes the process in which DNA sequence becomes transcribed and translated into protein. The Central Dogma gives us the framework to work backwards from a given protein sequence and infer the DNA sequence that the protein is derived from. Using one of the tools discussed in class, NCBI or online tools (google “reverse translation tools”), determine the nucleotide sequence that corresponds to the protein sequence you chose above.

A) I used an online reverse translation website to obtain the DNA sequence from which the amino acid sequence was derived.

ATGAATCAAGCCTCCGTAGTCGCTAACCAACTCATACCGATCAATACAATGTTAACACTCGTAATGATGAGGAGTGAGGT CGTGACACCTGTAGGAATTCCTGCTGAAGACATTCCCAGACTAGTCTCTATGCAAGTTAACAGGGCAGTGCCATTGGGAA CAACGTTAATGCCCGACATGGTAAAGGGATACGCCGCC

3.3. Codon optimization.

Once a nucleotide sequence of your protein is determined, you need to codon optimize your sequence. You may, once again, utilize google for a “codon optimization tool”. In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?

A) Reverse translation does not always give the exact unique DNA sequence that produced this protein but it gives the most likely sequence out of many possibilities. This is why we optimize the sequence we got to best accommodate the species. Dna optimization ensures that the process of translation is done as smoothly as possible. i have personally tried several optimizing tools but i came up with a lot of errors and premature stop codons, i believe it is due to the fact that i am using a fairly uncommon gene, which makes it hard to optimize it for human use

3.4. You have a sequence! Now what?

What technologies could be used to produce this protein from your DNA? Describe in your words the DNA sequence can be transcribed and translated into your protein. You may describe either cell-dependent or cell-free methods, or both.

A) the most realistic human application of this protein is during organ freezing. given the sensitivity of such applications, the yeild must be extremely pure and consistent. the method must be cell dependant (using a living organism to manifacture the protein) in this case i decided on using yeast Pichia pastoris. it is true that E.coli bacteria is the most common in cell dependant methods, however it cannot be used for human clinical applications because it produces endotoxins. yeast, p.pastoris is a eukaryote and does not produce endotoxins. yeast cells also contain an endoplasmic riticulum that ensures that the 66 aa chain is folded correctly into its 3d shape that allows it to bind to ice crystals.

transcription and translation:

1. the optimized DNA sequence is inserted into a plasmid and integrated into the yeast cells.
2. the promoter attached to the sequence acts as a trigger to initiate the trascription process where RNA polymerase enters the yeast nuclues and reads the sequence to build a matching mRNA strand which in turn carries the instructions from the DNA to the ribosome.
3. once it reaches the ribosome, the ribosome reads the optimized sequence, producing a protein chain.
4. the protein chain enters the endoplasmic reticulum where the chaperones help in folding it into its final 3d shape. .
5. the purified HPLC12 is added in low concentrations to the medium, preventing ice crystals from growing large enough to puncture the membranes of perserved organs in sub zero temperatures.

4.1, 4.2) Build Your DNA Insert Sequence. A) since i am using yeast (Pichia Pastoris) i selected the GAP promoter. GAP is a naturally occuring metabloic enzyme in yeast which makes its promoter highly compatible with Oichia Pastoris. it is constantly active and does not require Methanol to perform, unlike the AOX1 promoter. As for the ribosome binding site, eukaryotic systems do not generally require a sequence based binding site. Everything else followed the procedure (inserting the HPLC12 DNA sequence, His tag, Stop codon) The terminator I selected is the AOX1 TT which is the most common choice of terminator for pichia pastoris. the need for a stable terminator is prominant in ichia pastoris because of its strong promoters, necessitating that the mRNA is efficiently cut.

4.6) choose your vector.

5.1 DNA Read (i) What DNA would you want to sequence (e.g., read) and why? This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank).

A) i would like to sequence the HTT gene (Huntington’s disease), what causes the disease is the extensive CAG repeats. when these repeats exceed 36, it becomes pathogenic. this diseases degenrates the neural cells in the brain, causing the progressive loss of motor functions and loss of cognition. why? because it may assist in early detection and, in understanding it more, editing the gene to prevent aggregation and the rapid repeat in the CAG regions.

(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why? Also answer the following questions:

Is your method first-, second- or third-generation or other? How so? What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps. What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)? What is the output of your chosen sequencing technology?

1. the best option to sequence this would be the Oxford Nanopore sequencing. its third generation. it reads only single DNA molecules at a time, lessening error percentage. it provides long reads. and it does not utilize PCR, which is prone to producing errors (critical when dealing with HTT where diagnosis relies on the exact number of CAG repeats)
2. input: genomic DNA (blood or saliva) preparing: the dna is extracted, fragmented, ligating adapters to help the machine recognize the DNA, load DNA into the nanopore cell.
3. how it works: the DNA passes through nanopore where theres an electric current running, each base causes a different shift in the current, the signals are recorded and converted into a base sequence.
4. output: it produces long DNA reads and digital data (FASTQ) which would provide information on the exact number of CAG repeats and the possible mutations.

5.2 DNA write. (i) What DNA would you want to synthesize (e.g., write) and why? These could be individual genes, clusters of genes or genetic circuits, whole genomes, and beyond. As described in class thus far, applications could range from therapeutics and drug discovery (e.g., mRNA vaccines and therapies) to novel biomaterials (e.g. structural proteins), to sensors (e.g., genetic circuits for sensing and responding to inflammation, environmental stimuli, etc.), to art (DNA origamis). If possible, include the specific genetic sequence(s) of what you would like to synthesize! You will have the opportunity to actually have Twist synthesize these DNA constructs! :)

A) To tie back into my 5.1 answer, i would like to synthesise a therapeutic construct targetting HTT using CRISPR technique. it would provide instructions for RNA to target mutant HTT, and adding CAS9 to cut the targeted DNA. it should work to cut the repeats in the HTT gene.

(ii) What technology or technologies would you use to perform this DNA synthesis and why? Also answer the following questions:

What are the essential steps of your chosen sequencing methods? What are the limitations of your sequencing method (if any) in terms of speed, accuracy, scalability?

A) i would use the Phosphoramidite DNA synthesis which builds DNA one base at a time. And its perfect for short sequences ( we are not synthsizing the entire HTT gene but a guide DNA that targets the repeat region.) the essential steps: fix one nucleotide as a starting point onto a solid surface, The elongation cycle, which involves deprotection, coupling, capping, and oxidation. the cycle is repeated until the full dna sequence is produced, the DNA strand is detached and then purified. limitation: it is very expensive for long sequences, and it is very limited with the length of DNA it can synthesize.

5.3 DNA Edit (i) What DNA would you want to edit and why? In class, George shared a variety of ways to edit the genes and genomes of humans and other organisms. Such DNA editing technologies have profound implications for human health, development, and even human longevity and human augmentation. DNA editing is also already commonly leveraged for flora and fauna, for example in nature conservation efforts, (animal/plant restoration, de-extinction), or in agriculture (e.g. plant breeding, nitrogen fixation). What kinds of edits might you want to make to DNA (e.g., human genomes and beyond) and why?

A) I would want to edit the mutant HTT gene in the human nueral cells to remove CAG repeats. I would use CRISPR/CAS9 where CRISPR use the guide RNA to bind to the targeted DNA and the CAS9 enzyme would cut the double stranded DNA, the process should be followed by NHEJ and HDR repairs. 1) design the gRNA, place the CRISPR system into the cell, CAS9 cute the DNA, cell repairs. 2) cutting in the wrong places, harming the natural HTT gene instead of targetting the repeat area, and insefficient repairs.

Week 3 HW: Lab automation

Generate an artistic design using the GUI at opentrons-art.rcdonovan.com.

)

Using the coordinates from the GUI, follow the instructions in the HTGAA26 Opentrons Colab to write your own Python script which draws your design using the Opentrons.

A) I have obtained the GUI coordinates, but by the time i got around to run the coordinates on the opentron Colab, the website had stopped responding to the codes. and so i was unable to use the website as instructed or access the coordinates again.

For this week, we’d like for you to do the following:

Find and describe a published paper that utilizes the Opentrons or an automation tool to achieve novel biological applications.

A) Soh, B. W., Chitre, A., Tan, S. Z., Wang, Y., Yi, Y., Soh, W., Hippalgaonkar, K., & Wilson, D. I. (2025). Opentrons for automated and high‑throughput viscometry. Digital Discovery, 4, 711–722. https://doi.org/10.1039/d4dd00368c

this paper demonstrates their use for opentron OT2 liquid handling robot by turning it into a viscometer. the traditional way of measuring the viscosity for several liquids is time consuming and hard to scale. the researchers using the robot developed a method where the opentron pipettes dispensed liquids at different flow speeds and recorded the difference between how each liquid dispended and what it means in terms of viscosity. the despensing patterns are recorded and fed into learning models to help with the accuracy of viscosity prediction.

Write a description about what you intend to do with automation tools for your final project. You may include example pseudocode, Python scripts, 3D printed holders, a plan for how to use Ginkgo Nebula, and more. You may reference this week’s recitation slide deck for lab automation details.

A) My main final project idea is to create rapid sepsis test strips that use a cell free system with GFP based biosensors that respond to sepsis biomarkers like IL-6. Cell free systems are very sensitive to errors, thus, opentron automation can significantly help in reproducibility and reliability in the procedure. it can also help me set up several CFPS reactions parallel to each other, containing different concentrations of the biomarkers, different biosensors, or different GFP trigger designs. designing and optimizing a biosensor strip requires many trials and screening many combinations– experimenting with different promoters, RBSs, sensor domains and outside conditions. going through this process manually would be extremely slow and prone to many errors if the procedure is not consistant in the way an automated procedure can be.

Week 1 Lab: Pipetting

Individual Final Project

Group Final Project