Callum Siegmund is an emerging bio/nano-artist who, since 2020, has been a resident at SymbioticA developing his practice of DNA nanosculptures. These nanosculptures draw on multiple different nanotechnologies (including DNA Origami) to control and sculpt DNAs form at the nanoscale; interweaving double helices into imperceptible 3D objects whose form and sequence have embedded peotics. His works reflect on the absurdity of bio and nanotechnology, expressing absurdity through humour and satire as a means of epistemologically critiquing and analysing the knowledge systems which construct our beliefs; be them scientific, religious, or conspiratorial
Prior to 2020, Callum spent 5 years studying neuroscience and skeletal muscle tissue engineering, learning the language of science with the end goal being to create biotechnological artworks. His passion and skill led to working with internationally esteemed artists such as Guy Ben-Ary and Nathan Thompson on their project Bricolage, which won an honorable mention award at the 2022 Ars Electronica.
Part 1: Benchling & In-silico Gel Art Make a free account at benchling.com Import the Lambda DNA. Simulate Restriction Enzyme Digestion with the following Enzymes: EcoRI HindIII BamHI KpnI EcoRV SacI SalI Create a pattern/image in the style of Paul Vanouse’s Latent Figure Protocol artworks. You might find Ronan’s website a helpful tool for quickly iterating on designs! [[lambaNEB.png]]
3: DNA Design Challenge 3.1. Choose your protein. In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose. Have chosen Channelrhodopsin-2 a transmembrane ion transporter whose open/close state is dependent upon UV light hitting it. This basically means that we have unprecedented control over supressing or inducing neuronal activation via ion flow into cell, leading to exzternal neuronal control with some pretty crazy behavioural studies discovering the neuronal circuitry regulating behaviours such as eating, satiety, agression, and even target tracking during hunting in mice and dogs.
Subsections of Homework
Week 2 HW: DNA ~~ Read, Write, and Edit
Part 1: Benchling & In-silico Gel Art
Make a free account at benchling.com
Import the Lambda DNA.
Simulate Restriction Enzyme Digestion with the following Enzymes:
EcoRI
HindIII
BamHI
KpnI
EcoRV
SacI
SalI
Create a pattern/image in the style of Paul Vanouse’s Latent Figure Protocol artworks.
You might find Ronan’s website a helpful tool for quickly iterating on designs!
[[lambaNEB.png]]
3: DNA Design Challenge
3.1. Choose your protein.
In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose.
Have chosen Channelrhodopsin-2 a transmembrane ion transporter whose open/close state is dependent upon UV light hitting it. This basically means that we have unprecedented control over supressing or inducing neuronal activation via ion flow into cell, leading to exzternal neuronal control with some pretty crazy behavioural studies discovering the neuronal circuitry regulating behaviours such as eating, satiety, agression, and even target tracking during hunting in mice and dogs.
tr|B4Y105|B4Y105_VOLCA Channelrhodopsin-2 OS=Volvox carteri f. nagariensis OX=3068 PE=2 SV=1
MDHPVARSLIGSSYTNLNNGSIVIPSDACFCMKWLKSKGSPVALKMANALQWAAFALSVIILIYYAYATWRTTCGWEEVYVCCVELTKVVIEFFHEFDEPGMLYLANGNRVLWLRYGEWLLTCPVILIHLSNLTGLKDDYNKRTMRLLVSDVGTIVWGATAAMSTGYIKVIFFLLGCMYGANTFFHAAKVYIESYHTVPKGLCRQLVRAMAWLFFVSWGMFPVLFLLGPEGFGHLSVYGSTIGHTIIDLLSKNCWGLLGHFLRLKIHEHILLYGDIRKVQKIRVAGEELEVETLMTEEAPDTVKKSTAQYANRESFLTMRDKLKEKGFEVRASLDNSGIDAVINHNNNYNNALANAAAAVGKPGMELSKLDHVAANAAGMGGIADHVATTSGAISPGRVILAVPDISMVDYFREQFAQLPVQYEVVPALGADNAVQLVVQAAGLGGCDFVLLHPEFLRDKSSTSLPARLRSIGQRVAAFGWSPVGPVRDLIESAGLDGWLEGPSFGLGISLPNLASLVLRMQHARKMAAMLGGMGGMLGSNLMSGSGGVGLMGAGSPGGGGGAMGVGMTGMGMVGTNAMGRGAVGNSVANASMGGGSAGMGMGMMGMVGAGVGGQQQMGANGMGPTSFQLGSNPLYNTAPSPLSSQPGGDASAAAAAAAAAAATGAASNSMNAMQAGGSVRNSGILAGGLGSMMGPPGAPAAPTAAATAAPAVTMGAPGGGGAAASEAEMLQQLMAEINRLKSELGE
3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.
The Central Dogma discussed in class and recitation describes the process in which DNA sequence becomes transcribed and translated into protein. The Central Dogma gives us the framework to work backwards from a given protein sequence and infer the DNA sequence that the protein is derived from. Using one of the tools discussed in class, NCBI or online tools (google “reverse translation tools”), determine the nucleotide sequence that corresponds to the protein sequence you chose above.
Once a nucleotide sequence of your protein is determined, you need to codon optimize your sequence. You may, once again, utilize google for a “codon optimization tool”. In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?
CODON OPTIMIZED v
ATGGATCATCCGGTGGCTCGCAGCCTGATCGGATCGAGCTACACCAATCTGAACAACGGATCGATCGTGATCCCCAGCGATGCCTGCTTCTGTATGAAGTGGCTGAAGTCCAAGGGCTCGCCGGTGGCCCTGAAGATGGCCAACGCCCTGCAGTGGGCCGCCTTCGCCCTGTCGGTCATCATCCTGATCTACTATGCCTACGCCACCTGGCGCACGACCTGCGGATGGGAGGAGGTCTACGTGTGCTGCGTGGAGCTGACCAAGGTCGTGATCGAGTTCTTCCACGAGTTCGACGAGCCCGGCATGCTGTATCTGGCCAACGGCAACCGGGTGCTGTGGCTGCGCTATGGAGAGTGGCTGCTGACCTGCCCAGTGATCCTGATCCACCTGTCGAACCTGACCGGCTTGAAGGATGACTACAACAAGCGCACCATGCGCCTGCTCGTGAGCGATGTGGGTACCATCGTCTGGGGCGCGACCGCCGCTATGTCCACCGGCTACATCAAGGTCATCTTTTTTCTGTTGGGCTGCATGTACGGCGCCAATACTTTCTTCCACGCCGCTAAGGTGTACATTGAGAGTTACCACACCGTGCCAAAGGGCCTGTGCCGCCAGCTGGTCCGCGCCATGGCCTGGCTGTTCTTTGTGAGCTGGGGAATGTTCCCCGTTCTGTTCCTGCTGGGCCCCGAGGGATTCGGCCATTTGTCGGTGTATGGGAGCACGATAGGCCACACCATCATTGACCTGCTGAGCAAGAACTGCTGGGGCCTCTTGGGCCACTTCCTGAGGCTGAAGATCCACGAGCACATCCTGCTGTATGGTGATATCCGCAAGGTGCAGAAGATCCGCGTGGCCGGCGAGGAGCTGGAAGTGGAAACCTTGATGACCGAGGAAGCCCCCGATACGGTGAAGAAATCGACCGCCCAGTACGCCAATCGCGAGTCCTTCCTGACGATGCGCGATAAGCTGAAGGAGAAGGGCTTTGAGGTGCGCGCCAGCCTGGACAATTCCGGAATCGACGCCGTGATCAATCACAACAACAATTACAACAATGCCCTGGCTAACGCCGCAGCCGCCGTGGGTAAGCCCGGAATGGAGCTCTCCAAGCTGGATCACGTGGCGGCCAATGCCGCCGGAATGGGCGGAATCGCCGACCACGTGGCGACAACCTCCGGCGCCATCAGTCCGGGACGCGTGATCCTGGCCGTGCCCGATATTTCGATGGTGGACTACTTTCGAGAGCAGTTCGCCCAGTTGCCTGTGCAGTACGAGGTGGTGCCCGCCCTGGGCGCGGATAATGCCGTTCAGCTGGTAGTGCAGGCCGCCGGCCTGGGCGGCTGCGACTTTGTGTTGCTGCACCCCGAGTTTCTGCGCGATAAGTCTAGCACCTCGCTGCCGGCCCGCCTGCGCAGCATCGGCCAGCGAGTGGCCGCCTTCGGCTGGTCCCCAGTGGGTCCCGTGCGCGATCTGATCGAAAGCGCTGGCTTGGATGGATGGCTGGAAGGCCCCAGCTTCGGCTTGGGAATCTCTCTGCCGAACCTGGCCAGCCTGGTGCTGCGGATGCAACACGCTAGGAAGATGGCCGCCATGCTGGGCGGCATGGGCGGCATGCTGGGATCCAACCTGATGTCCGGAAGCGGAGGCGTGGGTCTGATGGGAGCAGGCTCGCCAGGTGGCGGCGGAGGAGCCATGGGCGTTGGCATGACCGGCATGGGCATGGTGGGTACCAATGCCATGGGCCGCGGCGCCGTGGGAAATAGCGTGGCCAATGCGAGCATGGGCGGCGGATCGGCCGGCATGGGAATGGGCATGATGGGCATGGTCGGCGCCGGCGTCGGAGGTCAGCAGCAGATGGGAGCAAATGGCATGGGACCCACCTCCTTCCAGCTGGGCAGCAATCCCCTGTATAACACCGCTCCGTCCCCGCTGTCGAGCCAGCCTGGCGGTGACGCCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCACCGGCGCCGCCTCCAACTCGATGAACGCCATGCAGGCTGGCGGCTCCGTGCGAAACTCGGGTATACTGGCCGGCGGCTTGGGATCGATGATGGGCCCTCCGGGAGCTCCGGCCGCTCCCACCGCGGCTGCCACGGCTGCCCCAGCCGTGACCATGGGAGCCCCGGGCGGAGGCGGAGCCGCCGCCAGCGAGGCCGAGATGCTGCAGCAGTTGATGGCAGAGATAAACCGCCTGAAGAGCGAGCTGGGTGAG
Codon optimization needed to firstly remove any enzyme sites that may also be required in gene processing, such as why the three TypeII restriction enzymes were avoided in the final optimized sequence to prevent unwanted cuts during golden gate assembly protocol… If the sequence is there the enzyme will bind to it, so need to remove it!.
Additionally, codon optimization allows us to hit similar GC % content as the host genome reducing chances of abnormal secondary/tertiary chromosome structure formation and failed transcription.
3.4. You have a sequence! Now what?
What technologies could be used to produce this protein from your DNA? Describe in your words the DNA sequence can be transcribed and translated into your protein. You may describe either cell-dependent or cell-free methods, or both.
Ahhh ok, this is going to sound silly but I just realised that this was meant to be optimizing a protein for industrial use-case expression rather than scientific experiments, which in hindsight seems obvious… but I am crashing and need to sleep so will leave what I did with the channelrhodopsin-2 for expression in drosophila fruit fly, had the funny(sick? macarbe? sysiphean?) idea of somehow integrating the blue-light ChR2 with movement or something else, and creating a closed loop performance wherein the flies are driven towards a blue uv zapper, triggering ChR2-mediated neuronal activity and an action before they ever get close enough to die to the UV zapper.
5.1 DNA Read
(i) What DNA would you want to sequence (e.g., read) and why? This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank).
I have an iced matcha can which was last drunk by my cousin before he passed away (can was double contained when found after his passing). I have always wanted to sequence a swab taken from the can and see how much, if any, genetic archeological evidence is still present on the can; exploring the tensions between genetic/memetic histories.
Or, I would like to sequence aptamers which act as debug strands on DNA/RNA origami and protein sculptures. These aptamers can be designed with poor affinity to its target sequence, allowing for their displacement in the event of the intended component binding to form a larger assemblage. The ability to determine presence/absence of debug strands in solution would allow for multiple components to be introduced to bind and form a larger structure, assuming these components do not physically obstruct one another, then you could get a good idea about binding efficiency between all the parts, as well as confirmation of formation without the yield-reducing gel electrophoresis+precipitation or without costly AFM imaging of dna origami sculptures.
Honestly so many good possibilities, you could measure which sites on the DNA origami are fastest to bind which may provide important structural information in determining root cause of a final sculpture which will not fold.
(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why? Also answer the following questions:
Is your method first-, second- or third-generation or other? How so?
What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps.
What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)?
What is the output of your chosen sequencing technology?
5.2 DNA Write
(i) What DNA would you want to synthesize (e.g., write) and why? These could be individual genes, clusters of genes or genetic circuits, whole genomes, and beyond. As described in class thus far, applications could range from therapeutics and drug discovery (e.g., mRNA vaccines and therapies) to novel biomaterials (e.g. structural proteins), to sensors (e.g., genetic circuits for sensing and responding to inflammation, environmental stimuli, etc.), to art (DNA origamis). If possible, include the specific genetic sequence(s) of what you would like to synthesize! You will have the opportunity to actually have Twist synthesize these DNA constructs! :)
(ii) What technology or technologies would you use to perform this DNA synthesis and why? Also answer the following questions:
What are the essential steps of your chosen sequencing methods?
What are the limitations of your sequencing method (if any) in terms of speed, accuracy, scalability?
5.3 DNA Edit
(i) What DNA would you want to edit and why? In class, George shared a variety of ways to edit the genes and genomes of humans and other organisms. Such DNA editing technologies have profound implications for human health, development, and even human longevity and human augmentation. DNA editing is also already commonly leveraged for flora and fauna, for example in nature conservation efforts, (animal/plant restoration, de-extinction), or in agriculture (e.g. plant breeding, nitrogen fixation). What kinds of edits might you want to make to DNA (e.g., human genomes and beyond) and why?
I think this is a very difficult question… firstly, segueing “…dna editing is used in flora and fauna…” into what kind of edits might you want to see (eg. human genomes) is in my humble opinion beautiful priming for ideation without percieved consequences. While I get the course aims to excite and advertise to future scientists and industry biotechnologists, the implementation of GMO non-human fauna lacks the real socioeconomic concerns and accelerated class divisions that cultural works like GATACA have signposted. Added onto this is the concern I have that GM of human genomes will be influenced by big pharma, given the imposition that genetic engineering is attempting to mine for total solutions to problems that are being mitigated (subscription model when applied to stuff like proton-pump inhibitors and antacids is lucrative) by pharma products While the economic barriers to entry cannot be helped, I believe that one should be able to perform ANY arbitrary genomic modifications to themselves and ONLY themselves.
Really though, if I was to edit DNA it would be to design and introduce a “picture frame” (gene casette optimized to users genome) for the insertion and expression of any RNA origami /protein sculpture with the ability to choose site-specific installation of the sculptures based on promoters and cotranscriptional factors; allowing tuning of the sculptures location in the body as well as controlling the poetics and performatrivity of the sculptures via what actions/pathways induce or supress the sculptures expression. Heck, could even have post-translational modulation if that was important conceptually to the artwork being installed.
For instance, a kill switch could be designed and inserted into ones genome that only begins to express in the liminal space where the organism is dead but the individual cells are still alive and migrating.
That being said, in order to fund my site-specific genomic sculptures I will also happily inject these picture frames into anyone who wants the logos of Gucci, Louis Vuitton, or {your design here} coursing through their veins while walking down the street.