Projects

SARS-CoV-2 Ultra-Sensitive Single-Tube Biosensor (USTB)

Project Title: Field-Deployable Instrument-Free Diagnostics
Status: HTGAA 2026 Final Project Implementation

🔬 Project Concept

The USTB represents a paradigm shift from electronic signal detection to physical surface-state detection. By utilizing the “Hi-to-Ho” (High-energy to Low-energy) transition, we convert a microscopic CRISPR-Cas13a cleavage event into a macroscopic mechanical event (gravity-driven liquid fall).

Figure 1: Transition from a hydrophilic (anchored) to hydrophobic (falling) state.

🧬 Genetic Circuit Design

The circuit is engineered for high specificity targeting the SARS-CoV-2 N-gene. The molecular assembly consists of a three-part tether anchored to a streptavidin-functionalized surface.

Figure 2: Molecular architecture of the Cas13a/crRNA complex and bridge probe.

📦 Custom Oligo Order (Twist Bioscience)

To order these from Twist, navigate to the Custom DNA/RNA Oligo portal. Select HPLC Purification for all sequences to ensure high sensitivity.

🧪 Laboratory Reagents & Materials

🛠 Experimental Protocol

Phase 1: Tube Functionalization (The “Arming” Phase)

1. Prepare Probe: Reconstitute the Bridge Probe to 100 nM in 1x PBS.
2. Coat: Add 150 μL of probe to a Streptavidin-Coated 1.5 mL Tube.
3. Incubate: 30 minutes at room temperature.
4. Wash: Wash 3x with 200 μL PBS-T (0.05% Tween-20). This step is critical to remove unbound cholesterol that causes false positives.

Phase 2: Sample Preparation (HUDSON Lysis)

1. Mix: Combine saliva or nasal swab 1:1 with Lysis Buffer (100 mM TCEP / 2 mM EDTA).
2. Heat: Incubate at 95°C for 5 minutes.
3. Cool: Bring to room temperature. This releases viral RNA and inactivates endogenous RNases.

Phase 3: CRISPR Assay Procedure

1. Reaction: Add 11 μL of processed lysate to 100 μL of CRISPR Master Mix (Cas13a, crRNA, Reporter, Phenol Red) in the Armed Tube.
2. Buffer Note: Use a low-concentration Tris buffer (5 mM) to ensure the Phenol Red color change remains visible.
3. Incubate: Incubate at 37°C for 15–20 minutes.

Phase 4: Triple-Readout Interpretation

1. Gravity: Invert the tube 180°. Liquid Falls = Positive.
2. Fluorescence: View under 470nm Blue Light. Green Glow = Positive.
3. Color Change: Observe liquid color. Yellow = Positive; Pink/Red = Negative.

📊 Results Gallery

Figure 3: Documentation of experimental results and readout validation. #,Item Name,Sequence / Specification,Purpose 1,Bridge Probe,5’-/5Biosg/TTTTTTTTTTTTTTT rUrUrUrUrU rUrUrUrUrU TTTTTTTTTTTTTTT /3CholTEG/-3’,Surface anchor & Cleavage site 2,crRNA (N-gene),GAAUUUACCCUUCGGGGUAGUCUAAAU GGUGAUGCUGCUCUUG-CUUUGAGAG,Guide for Cas13a to find COVID 3,Fluorescent Reporter,5’-/56-FAM/rUrUrUrUrUrU/3BHQ_1/-3’,Optional: For fluorescence verification 4,LwaCas13a Protein,Recombinant Protein (approx. 1 mg/mL),“The ““Scissors”””

SARS-CoV-2 Ultra-Sensitive Single-Tube Biosensor (USTB)

Project Title: Field-Deployable Instrument-Free Diagnostics
Status: HTGAA 2026 Implementation Phase

🔬 Project Overview

The USTB project utilizes a “Hi-to-Ho” (High-to-Low energy) surface switch. By leveraging the collateral cleavage activity of CRISPR-Cas13a, we convert a microscopic RNA detection event into a macroscopic gravity-based readout.

Figure 1: Transition from a hydrophilic (anchored) to hydrophobic (falling) state.

🧬 Molecular Logic & Circuit Design

The genetic circuit is engineered for high specificity against the SARS-CoV-2 N-gene. It utilizes a three-segment molecular tether and a Cas13a/crRNA complex.

Figure 2: Molecular architecture of the Cas13a/crRNA complex and bridge probe.

📦 Custom Ordering Information

These sequences are optimized for the gravity switch. Note that the Bridge Probe is best ordered through IDT for reliable Cholesterol/Biotin dual-modification, while the crRNA and Reporter are ideal for Twist Bioscience.

🛠 Experimental Protocol (12 Steps)

Part 1: Preparation & Coating

1. Reconstitute Probes: Resuspend the Bridge Probe to 100 nM in 1x PBS.
2. Tube Coating: Add 150 μL of the probe into your Streptavidin-coated tubes.
3. Incubation: Incubate for 30 minutes at room temperature to allow the Biotin-Streptavidin bond to form.
4. Washing: Wash the tubes 3 times with 200 μL PBS-T (0.05% Tween-20). This removes unbound cholesterol that could cause false positives.
5. Surface Check: Verify coating by adding 20 μL of water; it should remain anchored (hydrophilic state) when the tube is tilted.

Part 2: Sample Lysis & CRISPR Activation

6. HUDSON Lysis: Mix saliva or nasal swab 1:1 with Lysis Buffer (100 mM TCEP / 2 mM EDTA).
7. Inactivation: Heat the mixture to 95°C for 5 minutes to release RNA and kill endogenous RNases.
8. Complex Assembly: Mix LwaCas13a enzyme and crRNA (50 nM each) in cleavage buffer.
9. Activation: Add 5 μL of your processed sample lysate to the CRISPR Master Mix and let sit for 5 minutes.

Part 3: Detection & Readout

10. Transfer: Pipette the activated CRISPR mix into your pre-functionalized “Armed Tube.”
11. Incubation: Incubate at 37°C for 20 minutes.
12. The “Gravity” Flip: Invert the tube 180°. Positive Result: The liquid falls to the cap. Negative Result: The liquid remains anchored at the bottom.

📊 Results Gallery

Figure 3: Documentation of experimental results showing fluorescence and gravity readouts.