Projects

SARS-CoV-2 Ultra-Sensitive Single-Tube Biosensor (USTB)

Project Title: Field-Deployable Instrument-Free Diagnostics
Status: HTGAA 2026 Final Project Implementation

🔬 Project Concept

The USTB represents a paradigm shift from electronic signal detection to physical surface-state detection. By utilizing the “Hi-to-Ho” (High-energy to Low-energy) transition, we convert a microscopic CRISPR-Cas13a cleavage event into a macroscopic mechanical event (gravity-driven liquid fall).

USTB Mechanism USTB Mechanism Figure 1: Transition from a hydrophilic (anchored) to hydrophobic (falling) state.


🧬 Genetic Circuit Design

The circuit is engineered for high specificity targeting the SARS-CoV-2 N-gene. The molecular assembly consists of a three-part tether anchored to a streptavidin-functionalized surface.

Genetic Circuit Schematic Genetic Circuit Schematic Figure 2: Molecular architecture of the Cas13a/crRNA complex and bridge probe.

📦 Custom Oligo Order (Twist Bioscience)

To order these from Twist, navigate to the Custom DNA/RNA Oligo portal. Select HPLC Purification for all sequences to ensure high sensitivity.

ItemExact Sequence (5′ → 3′)ModificationsRole
Bridge ProbeTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT rUrUrUrUrUrUrUrUrUrU5’: Biotin
3’: Cholesterol
Surface Switch: Anchors to the tube; (rU)10 is the cleavage site.
crRNAGAAUUAACCCUUCGGGGUAGUCUAAAUCGGUGAUGCUGCUCUUGCUUUGAGAGNone (Pure RNA)Guide: Directs Cas13a to the viral N-gene.
ReporterrUrUrUrUrU5’: 6-FAM
3’: BHQ-1
Optical Signal: Releases fluorescence upon cleavage.

🧪 Laboratory Reagents & Materials

ComponentFunction
Coated TubesStreptavidin-Coated 1.5 mL Tubes
Lysis AgentTCEP-HCl (100 mM)
RNase GuardSUPERase·In™ RNase Inhibitor
IndicatorPhenol Red Indicator (0.04%)
Hardware470nm Blue Light Transilluminator

🛠 Experimental Protocol

Phase 1: Tube Functionalization (The “Arming” Phase)

  1. Prepare Probe: Reconstitute the Bridge Probe to 100 nM in 1x PBS.
  2. Coat: Add 150 μL of probe to a Streptavidin-Coated 1.5 mL Tube.
  3. Incubate: 30 minutes at room temperature.
  4. Wash: Wash 3x with 200 μL PBS-T (0.05% Tween-20). This step is critical to remove unbound cholesterol that causes false positives.

Phase 2: Sample Preparation (HUDSON Lysis)

  1. Mix: Combine saliva or nasal swab 1:1 with Lysis Buffer (100 mM TCEP / 2 mM EDTA).
  2. Heat: Incubate at 95°C for 5 minutes.
  3. Cool: Bring to room temperature. This releases viral RNA and inactivates endogenous RNases.

Phase 3: CRISPR Assay Procedure

  1. Reaction: Add 11 μL of processed lysate to 100 μL of CRISPR Master Mix (Cas13a, crRNA, Reporter, Phenol Red) in the Armed Tube.
  2. Buffer Note: Use a low-concentration Tris buffer (5 mM) to ensure the Phenol Red color change remains visible.
  3. Incubate: Incubate at 37°C for 15–20 minutes.

Phase 4: Triple-Readout Interpretation

  1. Gravity: Invert the tube 180°. Liquid Falls = Positive.
  2. Fluorescence: View under 470nm Blue Light. Green Glow = Positive.
  3. Color Change: Observe liquid color. Yellow = Positive; Pink/Red = Negative.

Assay Readouts Assay Readouts Figure 3: Documentation of experimental results and readout validation. #,Item Name,Sequence / Specification,Purpose 1,Bridge Probe,5’-/5Biosg/TTTTTTTTTTTTTTT rUrUrUrUrU rUrUrUrUrU TTTTTTTTTTTTTTT /3CholTEG/-3’,Surface anchor & Cleavage site 2,crRNA (N-gene),GAAUUUACCCUUCGGGGUAGUCUAAAU GGUGAUGCUGCUCUUG-CUUUGAGAG,Guide for Cas13a to find COVID 3,Fluorescent Reporter,5’-/56-FAM/rUrUrUrUrUrU/3BHQ_1/-3’,Optional: For fluorescence verification 4,LwaCas13a Protein,Recombinant Protein (approx. 1 mg/mL),“The ““Scissors”””

SARS-CoV-2 Ultra-Sensitive Single-Tube Biosensor (USTB)

Project Title: Field-Deployable Instrument-Free Diagnostics
Status: HTGAA 2026 Implementation Phase

🔬 Project Overview

The USTB project utilizes a “Hi-to-Ho” (High-to-Low energy) surface switch. By leveraging the collateral cleavage activity of CRISPR-Cas13a, we convert a microscopic RNA detection event into a macroscopic gravity-based readout.

USTB Mechanism Concept USTB Mechanism Concept Figure 1: Transition from a hydrophilic (anchored) to hydrophobic (falling) state.


🧬 Molecular Logic & Circuit Design

The genetic circuit is engineered for high specificity against the SARS-CoV-2 N-gene. It utilizes a three-segment molecular tether and a Cas13a/crRNA complex.

Genetic Circuit Schematic Genetic Circuit Schematic Figure 2: Molecular architecture of the Cas13a/crRNA complex and bridge probe.

📦 Custom Ordering Information

These sequences are optimized for the gravity switch. Note that the Bridge Probe is best ordered through IDT for reliable Cholesterol/Biotin dual-modification, while the crRNA and Reporter are ideal for Twist Bioscience.

ComponentExact Sequence (5′ → 3′)ModificationVendor Recommendation
Bridge ProbeTTTTTTTTTTTTTTT rUrUrUrUrU rUrUrUrUrU TTTTTTTTTTTTTTT5’: Biotin-TEG
3’: Chol-TEG
IDT (Custom DNA/RNA Chimera)
crRNAGAAUUUACCCUUCGGGGUAGUCUAAAU GGUGAUGCUGCUCUUG-CUUUGAGAGNone (RNA)Twist (Custom RNA)
ReporterrUrUrUrUrU5’: 6-FAM
3’: BHQ-1
Twist (Custom RNA)

🛠 Experimental Protocol (12 Steps)

Part 1: Preparation & Coating

  1. Reconstitute Probes: Resuspend the Bridge Probe to 100 nM in 1x PBS.
  2. Tube Coating: Add 150 μL of the probe into your Streptavidin-coated tubes.
  3. Incubation: Incubate for 30 minutes at room temperature to allow the Biotin-Streptavidin bond to form.
  4. Washing: Wash the tubes 3 times with 200 μL PBS-T (0.05% Tween-20). This removes unbound cholesterol that could cause false positives.
  5. Surface Check: Verify coating by adding 20 μL of water; it should remain anchored (hydrophilic state) when the tube is tilted.

Part 2: Sample Lysis & CRISPR Activation

  1. HUDSON Lysis: Mix saliva or nasal swab 1:1 with Lysis Buffer (100 mM TCEP / 2 mM EDTA).
  2. Inactivation: Heat the mixture to 95°C for 5 minutes to release RNA and kill endogenous RNases.
  3. Complex Assembly: Mix LwaCas13a enzyme and crRNA (50 nM each) in cleavage buffer.
  4. Activation: Add 5 μL of your processed sample lysate to the CRISPR Master Mix and let sit for 5 minutes.

Part 3: Detection & Readout

  1. Transfer: Pipette the activated CRISPR mix into your pre-functionalized “Armed Tube.”
  2. Incubation: Incubate at 37°C for 20 minutes.
  3. The “Gravity” Flip: Invert the tube 180°. Positive Result: The liquid falls to the cap. Negative Result: The liquid remains anchored at the bottom.

Assay Readouts Assay Readouts Figure 3: Documentation of experimental results showing fluorescence and gravity readouts.

Readout MethodPositive (+)Negative (-)
GravityFallingHanging
FAM SignalGreen GlowNo Glow
Phenol RedYellowPink

May 13, 2026

Subsections of Projects

Individual Final Project: SARS-CoV-2 USTB

Ultra-Sensitive Single-Tube Biosensor (USTB)

🔬 Project Abstract

The USTB is an instrument-free diagnostic platform that converts molecular detection into a macroscopic visual signal: liquid motion. By leveraging the collateral cleavage activity of CRISPR-Cas13a, the sensor triggers a transition in surface wettability from Hydrophilic (Hi) to Hydrophobic (Ho). This project demonstrates a platform capable of achieving $\le 1$ aM sensitivity with a visual readout time of 1 minute.


🧬 The “Hi-to-Ho” Sensing Principle

The sensor utilizes a three-segment probe immobilized on the glass surface. This molecular assembly acts as a “trap door” for the sample liquid:

  1. Hi Group (Hydrophilic): An anchored 40T DNA segment that holds the liquid at the bottom of the tube.
  2. Res Group (Responsive): A 6U RNA bridge that serves as the cleavage site for activated Cas13a.
  3. Ho Group (Hydrophobic): A terminal Dodecane anchor that remains on the glass wall.

When the target viral RNA is present, the Cas13a enzyme is activated and shreds the Res Group. The hydrophilic “mask” is detached, leaving only the hydrophobic base. Gravity then overcomes the reduced surface tension, and the liquid falls.


🛠 Fabrication & Zone Architecture

The glass tube is engineered into three distinct chemical regions (ABC zones) to ensure high sensitivity and zero false-positives.

  • Region A (Bottom): The active sensing zone. Functionalized with the 3-segment probe using APTES and Glutaraldehyde cross-linking.
  • Region B (Middle): The hydrophobic threshold. Coated with 0.1% FAS-17 (Heptafluorodecyl trimethoxy silane) to create a “non-stick” band that prevents accidental liquid fall.
  • Region C (Top): The target zone. Treated with a plasma pen to ensure the liquid spreads instantly upon contact, providing a permanent visual result.

🧪 Technical Specifications & Ordering

For the SARS-CoV-2 N-gene target, the following components are utilized:

ComponentSequence (5’ to 3')ModificationsVendor Note
Bridge ProbeNH2-(T)40-(U)6-(CH2)125’: Amine / 3’: DodecaneOrder as individual tube
crRNAGAAUUUACCCUUCGGGGUAGUCUAAA...53nt Full GuidePure RNA
Reporter (Opt.)rUrUrUrUrUrU5’: 6-FAM / 3’: BHQ-1HPLC Purified

📋 Experimental Workflow

1. Sample Processing (HUDSON)

  • Mix the sample 1:1 with 100 mM TCEP-HCl / 2 mM EDTA.
  • Heat to 96°C for 5 minutes. This inactivates endogenous RNases and releases the target RNA.

2. CRISPR Reaction & Readout

  • Activation: Add 11 µL of lysate to 100 µL of Master Mix (Cas13a, crRNA).
  • Incubation: 15–20 minutes at 37°C.
  • Readout: Invert the tube. If the target is present, the liquid falls within 1 minute.

🟢 Optional: Dual-Accuracy Fluorescence

For verification, a FAM-rU6-BHQ reporter is included in the mix. Upon target detection, the tube will emit a bright green signal under 470nm blue light, providing an orthogonal confirmation to the gravity-based “flip.”


📈 Significance & Future Outlook

This USTB platform achieves $0.10-per-test affordability while maintaining the sensitivity of commercial RT-PCR kits (Ct values up to 36). Its modularity allows it to be rapidly adapted for environmental monitoring or agricultural pathogens by simply swapping the crRNA sequence.

Biosafety: All work is conducted using synthetic, non-infectious RNA fragments in a BSL-2 environment.

May 13, 2026

Final Project

  1. The Bridge Probe (The Gravity Switch)This is the “A-B-C” chimeric probe that anchors the hydrophobic cholesterol to the biotinylated glass surface.Sequence: 5’-[Biotin-TEG] TTT TTT TTT TTT TTT rUrU rUrU rUrU rUrU rUrU rUrU TTT TTT TTT TTT TTT [Cholesterol-TEG]-3’Structure: Biotin—(dT)15—(rU)10—(dT)15—Cholesterol.Notes: Ensure you specify TEG (Triethylene Glycol) spacers for both the Biotin and Cholesterol modifications. This prevents steric hindrance, allowing the Cas13a to access the central RNA (rU10) cleavage site easily.Purification: HPLC purification is required for this dual-modified chimeric oligo.2. crRNA (The SARS-CoV-2 N-Gene Guide)This guide RNA targets a highly conserved region of the SARS-CoV-2 Nucleocapsid (N) gene (specifically the N2 region).Sequence: 5’-GAA UUU ACC CUU CGG GGU AGU CUA AAU GGU GAU GCU GCU CUU GCU UUG AGA G-3’Breakdown: * Direct Repeat (DR): GAAUUUACCCUUCGGGGUAGUCUAAAUSpacer: GGUGAUGCUGCUCUUGCUUUGAGAGNotes: This must be ordered as a single-stranded RNA (ssRNA).3. Fluorescent Reporter (Optional Confirmation)If you are using fluorescence for secondary verification alongside the visual liquid motion, this is the standard reporter.Sequence: 5’-[6-FAM] rU rU rU rU rU [BHQ-1]-3’Notes: A simple poly-rU pentamer labeled with FAM and BHQ-1.4. Positive Control (Target Activator)To test your reaction mix without a clinical sample, order this synthetic RNA fragment that matches the N-gene target.Sequence: 5’-CUC UCA AAG CAA GAG CAG CAU CAC C-3’Quick Ordering Summary TableComponentSequence (5’ to 3’)TypeModificationBridge ProbeBiotin-TEG-T15-rU10-T15-Cholesterol-TEGDNA/RNABiotin (5’), Cholesterol (3’)crRNAGAAUUUACCCUUCGGGGUAGUCUAAAU-GGUGAUGCUGCUCUUGCUUUGAGAGRNANoneReporterFAM-rUrUrUrUrU-BHQ1RNA6-FAM (5’), BHQ-1 (3’)Target RNACUCUCAAAGCAAGAGCAGCAUCACCRNANonePro-Tips for Your Build:Purification Matters: Chimeric oligos (DNA mixed with RNA) like the Bridge Probe are notoriously tricky. Ask your supplier (like IDT or GenScript) for HPLC or PAGE purification to ensure you don’t get truncated products that might fail to anchor.Glass Preparation: Since you’re using glass tubes, remember that the surface silanization (typically with APTES or FAS-17) is the most sensitive step. If the “blank” group liquid is moving too fast, your FAS-17 concentration is likely a bit too high.

Ultra-Sensitive Single-Tube Biosensor (USTB): Triple-Readout Protocol

This comprehensive protocol integrates mechanical Gravity readout with biochemical fluorescence and visual color change for maximum reliability. This “Triple-Readout” system ensures high diagnostic specificity for SARS‑CoV‑2 (N‑gene) detection.


I. Procurement Guide: What to Order

From Twist Bioscience (Custom Oligos)

Twist is the preferred source for the high‑purity, modified RNA/DNA tethers required for the “Hi‑to‑Ho” switch. Order the following three sequences:

ItemSequence (5′ → 3′)Purpose
Bridge Probe (The Switch)5′-[Biotin]-(T)₄₀-(rU)₁₀-3′-[Cholesterol]Anchors to the tube and creates the hydrophilic surface that holds the liquid.
crRNA (The Guide)GAAUUAACCCUUCGGGGUAGUCUAAAUC-GGUGAUGCUGCUCUUG-CUUUGAGAG (specific to SARS‑CoV‑2 N‑gene)Guides Cas13a to the viral target.
Fluorescent Reporter (Visual 1)5′-[6-FAM]-rU-rU-rU-rU-rU-3′-[BHQ-1]Provides green fluorescence upon cleavage.

From Thermo Fisher / Fisher Scientific

ComponentCatalog / Search TermFunction
Coated TubesStreptavidin‑Coated 1.5 mL TubesBase surface for the “Hi‑to‑Ho” switch.
Lysis AgentTCEP‑HCl (100 mM)Odorless reducing agent for viral lysis.
RNase GuardSUPERase·In™ RNase InhibitorProtects RNA components from degradation.
pH IndicatorPhenol Red Indicator (0.04%)Visual signal 2: pink → yellow color shift.
EnzymeLwaCas13a (Leptotrichia wadei)Target‑activated CRISPR nuclease.

II. Step‑by‑Step Protocol

Part 1: Tube Functionalization (“Arming”)

Prepare these in advance; “Armed” tubes are stable for up to 30 days at 4 °C.

  1. Dilute Probe – Reconstitute your Bridge Probe to 100 nM in 1× PBS.
  2. Coat – Add 150 μL of probe solution to a Streptavidin‑Coated 1.5 mL tube.
  3. Incubate – Let sit for 30 minutes at room temperature (RT).
  4. Wash – Remove liquid and wash the tube 3 times with 200 μL of PBS‑T (1× PBS + 0.05% Tween‑20).
  5. Dry – Air‑dry and store in a sealed bag with a silica desiccant.

Part 2: HUDSON Sample Processing

This “instrument‑free” method releases RNA directly from saliva or nasal swabs.

  1. Mix – Combine 50 μL of sample with 50 μL of Lysis Buffer (100 mM TCEP‑HCl + 2 mM EDTA).
  2. Heat – Incubate at 95 °C for 5 minutes (heat block or boiling water works).
  3. Cool – Allow the lysate to reach RT before adding it to the CRISPR mix.

Part 3: Triple‑Readout CRISPR Reaction

Assemble the master mix on ice before adding the sample.

Master Mix Assembly (100 μL per test):

ComponentFinal Concentration
LwaCas13a500 nM
crRNA500 nM
FAM‑rU₅‑BHQ1 Reporter1 μM
Phenol Red0.04%
SUPERase·In1 U/μL
Buffer5 mM Tris‑HCl (pH 8.8) + 10 mM MgCl₂

Note: Low buffer capacity is critical for the color shift.

  1. Reaction – Add 11 μL of lysate to 100 μL of master mix inside your Armed Tube.
  2. Incubation – Incubate at 37 °C for 15–20 minutes.

III. Interpretation of Results

ReadoutPositive (+)Negative (−)
Gravity (Flip)Liquid falls to the capLiquid stays anchored at the bottom
FluorescenceBright green (under 470 nm light)No visible glow
Color ChangeYellow (pH drop)Pink/Red (no change)

Thermo Scientific Pierce TCEP‑HCl
A potent, odorless reducing agent. High‑purity TCEP ensures complete viral lysis and stable RNA for attomolar detection.

Thermo Scientific Pierce TCEP‑HCl, No‑Weigh Format – $186.00
Thermo Fisher Scientific

Fisher Scientific SUPERase·In RNase Inhibitor
Essential for maintaining CRISPR reaction activity even in “dirty” clinical samples. More stable across a wide temperature range than traditional inhibitors.

Fisher Scientific SUPERase·In RNase Inhibitor (20 U/μL) – $227.00
Invitrogen