Individual Final Project
HTGAA 2026: Individual Final Project Report
SECTION 1: ABSTRACT
My final project is to build and test an ultra-sensitive single-tube biosensor (USTB) for rapid, instrument-free detection of SARS-CoV-2 RNA, the virus that causes COVID-19. This device lets anyone detect the virus by simply adding a sample to a specially coated glass tube, waiting one minute, and flipping the tube upside down — if the liquid stays stuck at the bottom, the test is positive; if it falls, it’s negative.
The significance is huge: current COVID tests either need expensive lab machines or are not sensitive enough for early or low-viral-load cases, especially in low-resource areas. My broad objective is to replicate and adapt the 2025 Science Advances biosensor so that it costs only $0.10 per test, works in 1 minute, and reaches attomolar (≤1 aM) sensitivity — far better than many commercial PCR kits.
My hypothesis is that a CRISPR-Cas13a-triggered wettability switch on the tube surface will reliably detect the conserved N-gene RNA of SARS-CoV-2. Specific aims include (1) fabricating the surface-modified tubes and testing with synthetic RNA, (2) validating detection on simulated clinical lysates, and (3) laying the groundwork for a deployable, equitable diagnostic tool that could transform pandemic response worldwide.
I will use glass-tube surface chemistry, Twist-ordered DNA/RNA probes, recombinant Cas13a, and a cheap plasma pen for fabrication, all performed in a standard synthetic-biology lab with basic pipettes and no fancy equipment. This project brings cutting-edge CRISPR biosensing into an affordable, visual format that anyone with basic lab access can build and use.
(Word count: 278)
SECTION 2: PROJECT AIMS
The first aim of my final project is to construct and functionally validate a working ultra-sensitive single-tube biosensor (USTB) for SARS-CoV-2 N-gene RNA detection by utilizing the Ho-to-Hi surface-modification protocol from Sheng et al. (2025), designing and ordering three-segment probe oligos plus crRNA via Twist Bioscience, expressing or purchasing LwaCas13a, and performing 1-minute visual liquid-motion assays on synthetic RNA targets and heat-lysed samples.
The second (medium-term) aim is to optimize the biosensor for real clinical nasal-swab lysates (Ct 26–36 range) and extend it to multiplex detection of influenza and other respiratory viruses by swapping only the crRNA sequence, creating a ready-to-deploy prototype that can be freeze-dried for field use.
The third (visionary, long-term) aim is to create an open-source, $0.10-per-test global diagnostic platform that eliminates the need for electricity, refrigeration, or trained technicians, thereby challenging the paradigm that ultra-sensitive nucleic-acid detection must be confined to centralized labs and enabling equitable pandemic preparedness in every community on Earth.
SECTION 3: BACKGROUND
Nucleic-acid detection for viruses like SARS-CoV-2 has relied heavily on RT-PCR and lateral-flow antigen tests, but both have limitations: PCR requires expensive thermocyclers and trained personnel, while antigen tests lack sensitivity at low viral loads. CRISPR-based methods (SHERLOCK and DETECTR) improved specificity and speed but still need fluorescence readers or lateral-flow strips, limiting affordability and portability in low-resource settings.
Sheng et al. (2025) introduced the USTB, a glass-tube device that uses CRISPR-Cas13a collateral cleavage to switch surface wettability, enabling naked-eye readout by liquid motion in 1 minute at ≤1 aM sensitivity — a breakthrough that outperforms commercial RT-PCR on clinical samples. Broughton et al. (2020) established CRISPR-Cas12a DETECTR for SARS-CoV-2 N-gene detection, proving CRISPR’s clinical utility but requiring additional instrumentation.
The critical knowledge gap this project fills is the absence of a truly instrument-free, sub-attomolar, visual CRISPR biosensor that can be built for pennies using only basic synthetic-biology tools and deployed anywhere without electricity or cold chain. By adapting the USTB specifically for SARS-CoV-2 in an HTGAA context, my project directly addresses this gap.
How my project is innovative
My project is innovative because it translates a 2025 publication into the first fully open-source, student-buildable version of an instrument-free CRISPR biosensor using only techniques already practiced in HTGAA (Twist ordering, primer design, surface chemistry). It challenges the current paradigm that ultra-sensitive nucleic-acid detection requires fluorescence readers or lateral-flow strips by replacing them with a simple gravity-based liquid-motion readout. It also pushes synthetic-biology boundaries by integrating CRISPR-Cas13a collateral cleavage with tunable surface chemistry on glass tubes, creating a modular platform where only the crRNA needs swapping to detect any new pathogen.
Significance of my final project
This project solves a pressing global-health problem: unequal access to sensitive COVID-19 (and future pandemic) diagnostics. In low- and middle-income countries, lack of infrastructure means many cases go undetected until too late for intervention. By delivering ≤1 aM sensitivity in 1 minute for $0.10 per test with zero instruments, the USTB directly addresses this critical barrier. It contributes to society by empowering community labs, field clinics, and even citizen scientists to perform high-accuracy testing. If successful, the concepts and methods will change clinical practice by making nucleic-acid testing as simple as a pregnancy test while retaining PCR-level sensitivity. It will improve scientific knowledge by demonstrating how wettability-switch biosensors can be rapidly prototyped in educational synthetic-biology settings.
Bioethical considerations
The main ethical implications involve biosafety (handling SARS-CoV-2 RNA or synthetic fragments requires BSL-2 practices), equitable access (who benefits from cheap diagnostics), and dual-use risk (the same technology could theoretically be misused for pathogen engineering). I apply the principles of non-maleficence (do no harm) by restricting work to synthetic RNA fragments or inactivated lysates and justice (fair distribution) by making all designs, protocols, and sequences fully open-source so low-resource communities are not left behind.
To ensure the project is ethical, I will (1) conduct all experiments in an approved BSL-2 lab following HTGAA biosafety protocols, (2) obtain IRB-exempt confirmation for using only synthetic or de-identified clinical lysates, and (3) publish all results and files on GitHub under Creative Commons. Potential unintended consequences include accidental release of reagents (mitigated by proper disposal) or over-reliance on the test without confirmatory PCR (addressed by clear instructions labeling it as a screening tool). My assumption that surface chemistry is perfectly reproducible may be incorrect; alternatives include starting with commercially available pre-coated tubes if needed.
SECTION 4: EXPERIMENTAL DESIGN
- Week 1–2: Literature review and sequence design — download Sheng et al. (2025) supplementary tables, design crRNA spacer for SARS-CoV-2 N gene and three-segment probe (NH₂-40T-6U-dodecane); expected: complete oligo sequences ready for ordering (1–2 days).
- Week 2: Order oligos via Twist Bioscience (probe, crRNA) and recombinant LwaCas13a or express in E. coli (DH5α chassis); expected: oligos arrive in 7–10 days.
- Week 3: Batch-prepare 50 glass tubes — clean with 3 M NaOH, APTES + glutaraldehyde functionalization (Region A), FAS-17 hydrophobic coating (Region B), PMMA protection, plasma treatment (Region C), probe attachment; timeline: 4–6 hours active + overnight incubations.
- Week 4: Prepare CRISPR reaction mix (Cas13a 40 nM + crRNA 20 nM + phenol red + buffer); expected: functional cocktail stored at –20 °C.
- Week 4–5: Test with synthetic SARS-CoV-2 N-gene RNA (Twist gBlock, 1 aM–100 fM dilutions) — add 11 µl sample + 99 µl mix to tube, wait 1 min, invert; expected: positive tubes show liquid hanging, negatives fall; record photos/video.
- Week 5: Test heat-lysed simulated clinical samples (spiked negative swabs); expected: detection down to Ct-equivalent 36.
- Week 6: Data analysis — quantify success rate (>95 % accuracy), optimize plasma time or probe concentration if needed; expected: final optimized protocol.
- Week 7: Freeze-dry tubes + mix for stability testing; expected: 4-week shelf-life data.
- Week 8: Prepare report, GitHub repository with all sequences and protocols.
(Workflow diagram: Tube prep → CRISPR mix → Sample addition → Invert & read — will be inserted as a simple flowchart on the webpage.)
SECTION 5: TECHNIQUES, TOOLS, AND TECHNOLOGY
Checked techniques relevant to my project:
- Pipetting
- Lab Safety
- Bioethical Considerations
- DNA Construct Design
- Databases (e.g., GenBank, NCBI)
- Creating Twist Order
- CRISPR/Cas9 (adapted to Cas13a workflow)
- Primer Design or Selection
- Bacterial Culturing (for Cas13a expression if homemade)
- Plasmid Preparation
Two techniques explained in detail
I will utilize DNA Construct Design by using NCBI/GenBank to select the conserved SARS-CoV-2 N-gene region, then manually design the crRNA spacer (20–28 nt complementary to target) and the three-segment probe (NH₂-40T DNA – 6U RNA responsive – dodecane hydrophobic) following Sheng et al. (2025) rules; this ensures specificity while keeping cost under $0.50 per oligo.
I will also use Creating Twist Order by uploading the exact probe and crRNA sequences (with 5′ NH₂ modification and any necessary linkers) directly into the Twist Bioscience portal, selecting the lowest-cost synthesis scale (25 nmol), and incorporating barcodes for easy tracking — exactly as practiced in the CRISPR week of class.
SECTION 6: PROJECT VALIDATION
10a. I chose to validate the “DNA Construct Design” aspect by creating the exact crRNA and three-segment probe sequences specific to the SARS-CoV-2 N gene that will be used in the final USTB. This is a core requirement before ordering and ensures the biosensor will recognize the correct target.
10b. Detailed validation protocol
- Retrieved the SARS-CoV-2 N-gene reference sequence from NCBI (NC_045512.2, positions ~28,274–28,533).
- Selected a 25-nt conserved spacer region.
- Designed crRNA: LwaCas13a direct repeat + spacer.
- Designed probe: NH₂-(T)₄₀-(U)₆-(CH₂)₁₂.
- Verified specificity with NCBI BLAST.
- Uploaded sequences to Twist Bioscience cart and confirmed order parameters.
10c. I utilized DNA Construct Design, Databases (NCBI/GenBank), Primer Design or Selection, and Creating Twist Order. These are core synthetic-biology techniques taught in the course.
11. Challenges
The only unexpected challenge was that the exact spacer length recommended in Sheng et al. (2025) was not visible in the free PDF preview; I overcame this by cross-referencing with the Broughton et al. (2020) N-gene region. Potential future problems include plasma-pen variability (mitigated by testing 5 tubes per batch) or Cas13a activity loss (alternative: purchase recombinant from NEB).
SECTION 7: ADDITIONAL INFORMATION
12. References
- Sheng, Y. et al. (2025). A tube-based biosensor for DNA and RNA detection. Science Advances 11(18), eadu2271. https://doi.org/10.1126/sciadv.adu2271
- Broughton, J.P. et al. (2020). CRISPR–Cas12-based detection of SARS-CoV-2. Nature Biotechnology 38, 870–874. https://doi.org/10.1038/s41587-020-0513-4
- NCBI Reference Sequence: NC_045512.2 (SARS-CoV-2 genome).
13. Supply List & Budget
- Glass test tubes (10 mL, pack of 100): $8
- Plasma pen (AliExpress): $28 (one-time)
- Twist Bioscience oligos (probe + crRNA): $45
- Recombinant LwaCas13a or expression kit: $60
- Chemicals (NaOH, APTES, glutaraldehyde, FAS-17, PMMA, phenol red): $35
- Synthetic SARS-CoV-2 RNA fragment: $25
- Pipette tips, buffers, ethanol: $15
- Freeze-drying supplies: $10
Total startup budget: ~$226 (covers 100+ tests at <$0.10 each thereafter).
SARS-CoV-2 Ultra-Sensitive Single-Tube Biosensor (USTB)
Project Title: Field-Deployable Instrument-Free Diagnostics
Status: HTGAA 2026 Final Project Implementation
🔬 Project Concept
The USTB represents a paradigm shift from electronic signal detection to physical surface-state detection. By utilizing the “Hi-to-Ho” (High-energy to Low-energy) transition, we convert a microscopic CRISPR-Cas13a cleavage event into a macroscopic mechanical event (gravity-driven liquid fall).
Figure 1: Transition from a hydrophilic (anchored) to hydrophobic (falling) state.
🧬 Genetic Circuit Design
The circuit is engineered for high specificity targeting the SARS-CoV-2 N-gene. The molecular assembly consists of a three-part tether anchored to a streptavidin-functionalized surface.
Figure 2: Molecular architecture of the Cas13a/crRNA complex and bridge probe.
📦 Custom Oligo Order (Twist Bioscience)
To order these from Twist, navigate to the Custom DNA/RNA Oligo portal. Select HPLC Purification for all sequences to ensure high sensitivity.
| Item | Exact Sequence (5′ → 3′) | Modifications | Role |
|---|---|---|---|
| Bridge Probe | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT rUrUrUrUrUrUrUrUrUrU | 5’: Biotin 3’: Cholesterol | Surface Switch: Anchors to the tube; (rU)10 is the cleavage site. |
| crRNA | GAAUUAACCCUUCGGGGUAGUCUAAAUCGGUGAUGCUGCUCUUGCUUUGAGAG | None (Pure RNA) | Guide: Directs Cas13a to the viral N-gene. |
| Reporter | rUrUrUrUrU | 5’: 6-FAM 3’: BHQ-1 | Optical Signal: Releases fluorescence upon cleavage. |
🧪 Laboratory Reagents & Materials
| Component | Function |
|---|---|
| Coated Tubes | Streptavidin-Coated 1.5 mL Tubes |
| Lysis Agent | TCEP-HCl (100 mM) |
| RNase Guard | SUPERase·In™ RNase Inhibitor |
| Indicator | Phenol Red Indicator (0.04%) |
| Hardware | 470nm Blue Light Transilluminator |
🛠 Experimental Protocol
Phase 1: Tube Functionalization (The “Arming” Phase)
- Prepare Probe: Reconstitute the Bridge Probe to 100 nM in 1x PBS.
- Coat: Add 150 μL of probe to a Streptavidin-Coated 1.5 mL Tube.
- Incubate: 30 minutes at room temperature.
- Wash: Wash 3x with 200 μL PBS-T (0.05% Tween-20). This step is critical to remove unbound cholesterol that causes false positives.
Phase 2: Sample Preparation (HUDSON Lysis)
- Mix: Combine saliva or nasal swab 1:1 with Lysis Buffer (100 mM TCEP / 2 mM EDTA).
- Heat: Incubate at 95°C for 5 minutes.
- Cool: Bring to room temperature. This releases viral RNA and inactivates endogenous RNases.
Phase 3: CRISPR Assay Procedure
- Reaction: Add 11 μL of processed lysate to 100 μL of CRISPR Master Mix (Cas13a, crRNA, Reporter, Phenol Red) in the Armed Tube.
- Buffer Note: Use a low-concentration Tris buffer (5 mM) to ensure the Phenol Red color change remains visible.
- Incubate: Incubate at 37°C for 15–20 minutes.
Phase 4: Triple-Readout Interpretation
- Gravity: Invert the tube 180°. Liquid Falls = Positive.
- Fluorescence: View under 470nm Blue Light. Green Glow = Positive.
- Color Change: Observe liquid color. Yellow = Positive; Pink/Red = Negative.
📊 Results Gallery
Figure 3: Documentation of experimental results and readout validation.