Week 07 HW: Genetic circuits part II: Neuromorphic Circuits

Assignment Part 1: Intracellular Artificial Neural Networks (IANNs)

1. What advantages do IANNs have over traditional genetic circuits, whose input/output behaviors are Boolean functions?

Boolean network models contain a set of variables; each variable might have one of two possible values: false or true. In contrast, IANNs can approximate a wide range of nonlinear functions, obtaining multi-level outputs, which allows taking more precise decisions.

IANNs are designed to work with continuous signals, so they can be more robust to that variability than a circuit, making it easy to build big and complex systems. They can incorporate time and dynamics.

In conclusion, they are more flexible, compact, and accurate.

2. Describe a useful application for an IANN; include a detailed description of input/output behavior, as well as any limitations an IANN might face to achieve your goal.

IANN has been used to detect Gynecological lesions. Scientists used a PAPANET system that successfully identified the atypical cells in the cervical smear. The input to the IANN consists of digital images of cervical smears obtained from Pap tests. These images contain cells with varying morphological characteristics (normal and abnormal cells).

The IANN processes the images by reducing their dimensionality and extracting relevant features such as cell shape, size, texture, and nucleus-to-cytoplasm ratio. This is done automatically by the hidden layers without the need for manual feature selection by a pathologist. The output of the system is a classification of the cells or the entire image, typically normal or abnormal (e.g., presence of atypical or precancerous cells). In some cases, the system may also assign a probability score indicating the likelihood of abnormality.

Using IANN, the entire image can be flattened to fewer than 100 pixels, and data can be extracted without bias; feature extraction does not require expert pathologists.

Limitations:

  • This approach requires a team to implement an ANN in the laboratory. The team will consist of a data scientist, an engineer, and a cytologist (pathologist).
  • The hidden layer acts as a “black box”, making it difficult to interpret, control, and optimize how the system processes inputs and generates outputs.

3. Below is a diagram depicting an intracellular single-layer perceptron where the X1 input is DNA encoding for the Csy4 endoribonuclease and the X2 input is DNA encoding for a fluorescent protein output whose mRNA is regulated by Csy4. Tx: transcription; Tl: translation.

Assignment Part 2: Fungal Materials

1. What are some examples of existing fungal materials and what are they used for? What are their advantages and disadvantages over traditional counterparts?

1.Mycelium packaging foams

Companies grow mycelium packaging by inoculating agricultural waste (e.g., husks, stalks) with fungal mycelium, letting it bind into a solid, then drying it. It is molded into custom protective inserts that function similarly to expanded polystyrene (EPS) for shipping electronics, cosmetics, or food.

Advantages

  • 100% biodegradable/compostable in natural conditions, no microplastics.
  • Uses low-value agricultural byproducts as feedstock, reducing waste.
  • Good impact protection and thermal insulation comparable to EPS for many uses.

Disadvantages

  • Lower mechanical strength and durability than many petrochemical foams.
  • More sensitive to moisture and prolonged damp conditions; can degrade faster.
  • Scaling, consistency, and cost can be challenging compared with mature plastic supply chains.

2.Mycelium building and insulation materials

Mycelium is used as a building material in blocks/panels for non-load-bearing walls, cladding, and insulation. It is grown as a composite: mycelium binds plant fibers into rigid, lightweight bricks or panels.

Advantages

  • Very good thermal insulation and sound absorption; traps more heat than fiberglass in some tests.
  • Fire resistant and non-toxic when burned, unlike some synthetic foams.
  • Lightweight, 100% biodegradable, and can be composted or returned to soil at end of life.

Disadvantages

  • Pure mycelium has relatively low compressive strength; often unsuitable as a primary load-bearing structural material.
  • Water resistance often decreases over time, especially if not well protected, leading to mold/humidity issues and shorter lifespan in damp environments.
  • Mechanical performance is less predictable than concrete, steel, or engineered wood; more research and standards are needed.

3. Mycelium “leather” alternatives

Mycelium grown in controlled sheets or as fine composites is used as a leather alternative for fashion, accessories, and upholstery. Brands partner with biotech companies to supply sheet materials that can be cut and sewn like leather.

Advantages

  • Animal-free and typically plastic-free or low-plastic, addressing ethical and some environmental concerns.
  • Can be grown to targeted thickness and texture, and tuned via growth conditions and coatings.
  • Potentially lower land and water use and lower greenhouse-gas emissions than livestock-based leather.

Disadvantages

  • Raw mycelium sheets often lack the strength, flex resistance, and abrasion resistance of premium animal leather; they usually need reinforcement or coatings.
  • Many commercial products rely on polyurethane (PU) or similar synthetic coatings for durability, which reduces overall biodegradability.
  • Long-term durability, aging behavior, and large-scale cost competitiveness are still being proven.

2. What might you want to genetically engineer fungi to do and why? What are the advantages of doing synthetic biology in fungi as opposed to bacteria?

Objective: Engineering fungi to produce new antibiotics or variants of existing antibiotics that resistant bacteria cannot inactivate.

The concept involves modifying the genes or metabolic pathways of fungi that naturally produce antibiotics to create novel or more potent molecules.

Advantages of Using Fungi

  • They can produce complex metabolites that bacteria or yeasts cannot.
  • They allow for the modification of biosynthetic pathways more easily than plants do.

Limitations

  • Potential toxicity or side effects associated with the new compound.
  • Scaling up production to an industrial level can be complex.

Assignment Part 3: First DNA Twist Order

1. Review the Individual Final Project documentation guidelines.

2. Submit this Google Form with your draft Aim 1, final project summary, HTGAA industry council selections, and shared folder for DNA designs.

3. Review Part 3: DNA Design Challenge of the week 2 homework. Design at least 1 insert sequence and place it into the Benchling/Kernel/Other folder you shared in the Google Form above. Document the backbone vector that will be synthesized in on your website

Biosensor_A118G_GFP

This insert contains the A118G mutation recognition region, an inducible promoter activated by the binding of the protein of interest, the GFP reporter gene for visualization, and an intrinsic (rho-independent) terminator to stop transcription. Designed as a prototype biosensor for detecting SNPs in clinical samples

Backbone vector:

pUC19 (common example for expression in E. coli) — contains the ColE1 origin of replication and ampicillin resistance, compatible with the insertion of this construct and GFP expression testing.

GGTCAACTTGTCCCACTTAGATGGCGACCTGTCCGACCCATGCGGTCCGAAAACTGTTAATTAGTAGCCGAGCATATTACTACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAGGGTTAAGAACAACTTAATCTACCCTACAATTACCCGTGTTTAAAAGACAGTCACCTCTCCCACTTCCACTACGTTGTATGCCTTTTGAATGGGAATTTAAATAAACGTGATGACCTTTTGATGGACAAGGTACCGGTTGTGAACAGTGATGAAAGAGAATACCACAAGTTACGAAAAGTTCTATGGGTCTAGTATACTTTGCCGTACTGAAAAAGTTCTCACGGTACGGGCTTCCAATACATGTCCTTTCTTGATATAAAAAGTTCTACTGCCCTTGATGTTCTGTGCACGACTTCAGTTCAAACTTCCACTATGGGAACAATTATCTTAGCTCAATTTTCCATAACTAAAATTTCTTCTACCTTTGTAAGAACCTGTGTTTAACCTTATGTTGATATTGAGTGTGTTACATATGTAGTACCGTCTGTTTGTTTTCTTACCTTAGTTTCAATTGAAGTTTTAATCTGTGTTGTAACTTCTACCTTCGCAAGTTGATCGTCTGGTAATAGTTGTTTTATGAGGTTAACCGCTACCGGGACAGGAAAATGGTCTGTTGGTAATGGACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAAGAACTCAAACATTGTCGACGACCCTAATGTGTACCGTACCTACTTGATATGTTTATCTCAATCTAACTACGCGGCGATACGCGTTGCGTAAATAAA

References

  • Bangalore University. “E.coli Promoters.” Slideshare, 2018, es.slideshare.net/slideshow/ecoli-promoters/127916141#10. Accessed 22 Mar. 2026.
  • Brophy, Jennifer A N, and Christopher A Voigt. “Principles of Genetic Circuit Design.” Nature Methods, vol. 11, no. 5, 29 Apr. 2014, pp. 508–520, https://doi.org/10.1038/nmeth.2926.
  • Dey, Pranab. “Artificial Neural Network in Diagnostic Cytology.” Cytojournal, vol. 19, 2 Apr. 2022, p. 27, https://doi.org/10.25259/cytojournal_33_2021. Accessed 28 Nov. 2025.
  • Elsacker, Elise, et al. “Recent Technological Innovations in Mycelium Materials as Leather Substitutes: A Patent Review.” Frontiers in Bioengineering and Biotechnology, vol. 11, 7 Aug. 2023, www.ncbi.nlm.nih.gov/pmc/articles/PMC10441217/, https://doi.org/10.3389/fbioe.2023.1204861.
  • GSL Biotech LLC. “Tac Promoter Sequence and Map.” SnapGene, 2024, www.snapgene.com/plasmids/basic_cloning_vectors/tac_promoter.
  • Hatkar, Aishwarya, and Aditi Lanke. “Mycelium: An Eco-Friendly Construction Material.” International Journal of Engineering Research & Technology, vol. 10, no. 3, 11 Feb. 2022, www.ijert.org/mycelium-an-eco-friendly-construction-material, https://doi.org/10.17577/IJERTCONV10IS03042.
  • hugohek. “Grown-Design | Beautiful Products with Fungus and Biomass.” Grown.bio, 2022, www.grown.bio/.
  • Katz, Leslie. “This Furniture Is Made of Fungus.” Forbes, 10 Oct. 2023, www.forbes.com/sites/lesliekatz/2023/10/10/this-furniture-is-made-of-fungi/.
  • LLC, GSL Biotech. “GFP Sequence and Map.” Www.snapgene.com, www.snapgene.com/plasmids/fluorescent_protein_genes_and_plasmids/GFP.
  • “Mycelium Building Material | Local Green US Hubs.” Local Green US Hubs, 2020, www.gogreenlocally.org/sahproject/mycelium-building-material. Accessed 22 Mar. 2026.
  • Schwab, Julian D., et al. “Concepts in Boolean Network Modeling: What Do They All Mean?” Computational and Structural Biotechnology Journal, vol. 18, no. 18, 2020, pp. 571–582, https://doi.org/10.1016/j.csbj.2020.03.001.
  • Sustainability Directory. “Mycelium Leather Commercialization Secures Durable, Plastic-Free, Animal-Free Luxury Materials → Fashion.” News → Sustainability Directory, 18 Oct. 2025, news.sustainability-directory.com/fashion/mycelium-leather-commercialization-secures-durable-plastic-free-animal-free-luxury-materials/. Accessed 22 Mar. 2026.
  • ---. “What Are the Drawbacks of Mycelium? → Question.” Product → Sustainability Directory, 10 Apr. 2025, product.sustainability-directory.com/question/what-are-the-drawbacks-of-mycelium/.
  • “Tema 10.” Web.uah.es, 2026, biomolq.web.uah.es/BM/Esquemas/Tema10.htm?utm_source=chatgpt.com. Accessed 22 Mar. 2026.
  • You, Linlin, et al. “Structural Basis for Intrinsic Transcription Termination.” Nature, vol. 613, no. 7945, 1 Jan. 2023, pp. 783–789, www.nature.com/articles/s41586-022-05604-1, https://doi.org/10.1038/s41586-022-05604-1. Accessed 11 May 2023.