Week-2/Part-2 HW: DNA Read, Write, and Edit
5.1 DNA Read
answer: I’m interested in sequencing the PIK3CA gene of cancer cells (e.g., breast/colorectal cancer cells) from the co-culture version in 3D cardiac organoid. Because the PIK3CA mutations (common in 10-20% cancers) drive tumor growth and cardiotoxicity, sequencing helps study interactions in cardio-oncology models, advancing human health research (Keraite et al., 2020). It’s common to sequence it using NGS for the prognosis data, while another interesting fact that the DNA of the frog’s heart (xenopus) is also available for heart development studies (Hellsten et al., 2010).
(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why?
answer: I’d like to use the Nanopore sequencing technology since it’s more practical compared to the Sanger method. Nanopore offers long reads (up to Mb), real-time results, portable, and also cheaper for batch with >30 samples, and also sensitive for the variants/mixed samples (Layyaroz et al., 2025). I’ll use the nanopore technology to sequence the PIK3CA/Xenopus genome, because of the long reads help to proceed full gene assembly and detect mutations.
Also answer the following questions:
- Is your method first-, second- or third-generation or other? How so? What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps.
answer: Nanopore is third-generation sequencing: real-time, long-read (up to Mb), single-molecule without amplification bias. Input: Native DNA/RNA (e.g., PIK3CA amplicons or Xenopus extracts) (Alberto et al., 2018).
Preparation: Shear/fragmentation (optional for long reads), end-repair, adapter ligation (motor protein/leader), optional PCR for low-input.
Essential steps:
- Extract DNA;
- Fragment (e.g., shear)
- End-repair/dA-tailing
- Ligate adapters
- Load onto flow cell
- What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)? answer: Essential steps: 1) DNA/RNA translocates through nanopore, disrupting ionic current; 2) Raw signal captured; 3) Segmentation into events; 4) Neural network basecalling (e.g., transformer models preprocess signal via convolutions, encode with transformers, decode to bases). Base calling: Translates raw electrical signals to nucleotides using ML models (e.g., RNN/Transformers) predicting bases from current changes (Zhang et al., 2020).
- What is the output of your chosen sequencing technology? answer: the output are FASTQ/BAM files with sequences, quality scores, and optional alignments; real-time or post-run via basecallers like Dorado.
5.2 DNA Write
answer: DNA to synthesize: CRISPR gRNA targeting PIK3CA H1047R mutation (sequence: CGAACAGGTATCTACCATGG), plus telomere repeat inhibitor (TTAGGG repeats fused to TERT-targeting gRNA). Why? bacuse it can be utilized for cancer therapeutics—edit PIK3CA in 3D cardiac organoids to model cardio-oncology, inhibit telomerase (TERT) to shorten telomeres in cancer cells, reducing proliferation while studying heart effects (Wang et al., 2025).
answer: Phosphoramidite-based solid-phase DNA synthesis (e.g., via Twist Bioscience). It has high-fidelity for short oligos like gRNA (~20-100 bp), scalable for custom sequences targeting PIK3CA/TERT, cost-effective ($0.03/base), and enables rapid iteration in cancer therapeutics without enzymatic errors.
Also answer the following questions:
What are the essential steps of your chosen sequencing methods? answer: these are the essential steps of my chosen sequencing methods including extract and purify DNA (from cancer cells / organoid culture), ligate sequencing adapters + motor protein, load library onto the flow cell, apply voltage → DNA translocates through nanopore, and real-time electrical signal recording → basecalling (Dorado / Guppy).
What are the limitations of your sequencing method (if any) in terms of speed, accuracy, scalability? answer: I chose Oxford Nanopore (third-generation) because it gives long reads and real-time results, ideal for full-length PIK3CA and telomere analysis in organoids. The main limitation is slightly lower single-read accuracy (~90%), which is easily solved with higher coverage.
5.3 DNA Edit
answer: I would like to sythesize CRISPR gRNA targeting PIK3CA H1047R mutation (sequence: CGAACAGGTATCTACCATGG), plus telomere repeat inhibitor (TTAGGG repeats fused to TERT-targeting gRNA). I’d like to use it for cancer therapeutics—edit PIK3CA in 3D cardiac organoids to model cardio-oncology, inhibit telomerase (TERT) to shorten telomeres in cancer cells, reducing proliferation while studying heart effects.
answer: I’d like to use Phosphoramidite-based solid-phase DNA synthesis (e.g., via Twist Bioscience) technology, because high-fidelity for short oligos like gRNA (~20-100 bp), scalable for custom sequences targeting PIK3CA/TERT, cost-effective ($0.03/base), and enables rapid iteration in cancer therapeutics without enzymatic errors.
Also answer the following questions:
How does your technology of choice edit DNA? What are the essential steps? answer: CRISPR-Cas9 edits DNA by creating targeted double-strand breaks (DSBs), triggering cellular repair. Essential steps: 1) gRNA binds target sequence via base-pairing; 2) Cas9 nuclease cleaves DNA 3 bp upstream of PAM (NGG); 3) DSB repaired by NHEJ (indels) or HDR (precise edits).
What preparation do you need to do (e.g. design steps) and what is the input (e.g. DNA template, enzymes, plasmids, primers, guides, cells) for the editing? answer: Preparation: Design gRNA (e.g., for PIK3CA H1047R: CGAACAGGTATCTACCATGG; telomere: TTAGGG repeats + TERT gRNA); synthesize via phosphoramidite; form RNP complex. Input: gRNA, Cas9 protein (RNP), DNA template (for HDR), primers (verification), cells (cancer/organoid culture).
What are the limitations of your editing methods (if any) in terms of efficiency or precision? answer: Limitations: Efficiency—low HDR (~1-20%), high NHEJ preference, mosaicism in founders. Precision—off-target effects (≥50%), unintended mutations, PAM restrictions.
Source: Alberto Magi, Roberto Semeraro, Alessandra Mingrino, et al., 2018. Nanopore sequencing data analysis: state of the art, applications and challenges, Briefings in Bioinformatics, 19(6), pp. 1256–1272. Keraite, I., Alvarez-Garcia, V., Garcia-Murillas, I. et al. 2020. PIK3CA mutation enrichment and quantitation from blood and tissue. Sci Rep, 10, 17082. Hellsten U, Harland RM, Gilchrist MJ, et al. 2010. The genome of the Western clawed frog Xenopus tropicalis. Science, 328(5978): pp. 633-6. Larráyoz MJ, Luri-Martin P, Mañu A, et al. 2025. From Sanger to Oxford Nanopore MinION Technology: The Impact of Third-Generation Sequencing on Genetic Hematological Diagnosis. Cancers (Basel), 17(11): pp. 1811. Zhang YZ, Akdemir A, Tremmel G, et al. 2020. Nanopore basecalling from a perspective of instance segmentation.BMC Bioinformatics, 21:136.