Homework
Weekly homework submissions:
Week 1 HW: Principles and Practices
First, describe a biological engineering application or tool you want to develop and why Pattern-Based Rapid Diagnostic Platform for Dengue Virus: A rapid diagnostic platform for dengue virus (DENV) that integrates innate immune recognition, molecular recognition, and biosensor engineering to address key limitations of existing diagnostic methods. The proposed system combines mannose-binding lectin for the recognition of viral glycoproteins, dengue-specific aptamers targeting conserved regions of viral proteins, and signal transduction through a portable biosensor to enable rapid readout. This approach is motivated by the fact that current dengue diagnostics are often expensive and exhibit reduced sensitivity and reliability in dengue-endemic regions, particularly in countries like mine (Colombia), where prior flavivirus exposure compromises serological test performance and access to reliable diagnostics is limited by public healthcare infrastructure (Terenteva et al., 2025).
Week 2 HW: DNA Read, Write and Edit
Part 1: Benchling & In-silico Gel Art Part 3: DNA Design Challenge Protein: mannose-binding protein C precursor Reverse Translate: Aminoacids mslfpslpll llsmvaasys etvtcedaqk tcpaviacss pgingfpgkd grdgtkgekg epgqglrglq gppgklgppg npgpsgspgp kgqkgdpgks pdgdsslaas erkalqtema rikkwltfsl gkqvgnkffl tngeimtfek vkalcvkfqa svatprnaae ngaiqnlike eaflgitdek tegqfvdltg nrltytnwne gepnnagsde dcvlllkngq wndvpcstsh lavcefpi Nucleotid sequence atgagcctgtttccgagcctgccgctgctgctgctgagcatggtggcggcgagctatagc gaaaccgtgacctgcgaagatgcgcagaaaacctgcccggcggtgattgcgtgcagcagc ccgggcattaacggctttccgggcaaagatggccgcgatggcaccaaaggcgaaaaaggc gaaccgggccagggcctgcgcggcctgcagggcccgccgggcaaactgggcccgccgggc aacccgggcccgagcggcagcccgggcccgaaaggccagaaaggcgatccgggcaaaagc ccggatggcgatagcagcctggcggcgagcgaacgcaaagcgctgcagaccgaaatggcg cgcattaaaaaatggctgacctttagcctgggcaaacaggtgggcaacaaattttttctg accaacggcgaaattatgacctttgaaaaagtgaaagcgctgtgcgtgaaatttcaggcg agcgtggcgaccccgcgcaacgcggcggaaaacggcgcgattcagaacctgattaaagaa gaagcgtttctgggcattaccgatgaaaaaaccgaaggccagtttgtggatctgaccggc aaccgcctgacctataccaactggaacgaaggcgaaccgaacaacgcgggcagcgatgaa gattgcgtgctgctgctgaaaaacggccagtggaacgatgtgccgtgcagcaccagccat ctggcggtgtgcgaatttccgatt Codon optimization: ATG AGC CTT TTT CCG AGC CTT CCT CTG CTT TTA CTG TCG ATG GTG GCC GCC AGC TAC AGT GAA ACT GTG ACC TGT GAG GAC GCC CAA AAA ACG TGT CCT GCA GTT ATC GCG TGC AGC TCC CCG GGT ATC AAT GGC TTC CCC GGC AAG GAC GGG CGT GAT GGG ACT AAA GGC GAG AAA GGT GAA CCG GGA CAG GGC TTA CGT GGT TTA CAG GGC CCG CCG GGT AAA TTG GGG CCG CCA GGC AAT CCG GGT CCG AGT GGC TCC CCA GGG CCG AAA GGT CAG AAA GGC GAT CCA GGC AAA AGT CCG GAT GGT GAT TCA AGT CTG GCG GCC AGC GAA CGT AAG GCC CTT CAG ACC GAA ATG GCT CGT ATC AAA AAA TGG TTA ACG TTC AGC CTG GGG AAA CAA GTG GGG AAT AAG TTT TTT CTG ACT AAT GGC GAG ATC ATG ACG TTT GAG AAA GTG AAA GCG CTG TGT GTG AAG TTC CAG GCC AGC GTG GCG ACG CCA CGT AAC GCG GCG GAA AAT GGC GCG ATT CAA AAC CTT ATC AAA GAA GAG GCC TTC CTG GGT ATT ACG GAC GAA AAA ACG GAG GGC CAG TTT GTC GAT CTG ACT GGT AAC CGC TTA ACA TAT ACC AAT TGG AAT GAG GGC GAA CCT AAC AAC GCA GGC AGC GAT GAG GAC TGC GTG CTG TTA TTG AAA AAC GGC CAG TGG AAC GAC GTA CCT TGT TCC ACT AGC CAT TTA GCG GTA TGC GAA TTT CCG ATT
Opentrons Artwork opentrons-art.rcdonovan.com/?id=oevp91e27i3m061 Post-Lab Questions Find and describe a published paper that utilizes the Opentrons This article combines an open‑source liquid‑handling robot (Opentrons OT‑One‑S Hood) with four interchangeable modules that perform magnetic‑bead DNA isolation, isothermal recombinase polymerase amplification (RPA) of the ctrA gene, exonuclease digestion to generate single‑stranded DNA, and detection on a paper‑based vertical‑flow microarray (VFM) using anti‑biotin gold nanoparticles for colorimetric read‑out.