Subsections of Grace Hussey — HTGAA Spring 2026

Homework

Weekly homework submissions:

  • Week 1 HW: Principles and Practices

    Governance Assignment Biological Engineering Application Immunotherapies are a promising avenue in cancer treatment as they leverage the immune system’s innate ability to recognize and target non-self structures. However, traditional immunotherapies often result in on-target off-tumor effects, particularly in solid tumors. Synthetic biology has enabled new avenues of discovery to minimize this immunotherapy-related toxicity: engineering immune cells to target tumor-associated antigens (TAAs) or engineering genetic circuits to detect cancer disease signatures (Zhu et al., 2024). For example, modifying the traditional Chimeric Antigen Receptor (CAR) T-cell immunotherapy approach with a synthetic Notch (synNotch) receptor has demonstrated the ability to suppress off-target cytotoxicity related to organ rejection (Reddy et al., 2024) and selectively target cancerous cells in the central nervous system of mice rather than elsewhere in the body (Simic et al., 2024). Yet, while synNotch-modified CAR-T therapies show promise in their ability to reduce immunotherapy-related toxicity, additional research is needed to effectively administer these bioengineered cell systems in patients beyond pre-clinical experimentation.

  • Week 2 HW: DNA Read, Write, and Edit

    Part 1: Benchling and In-silico Gel Art Virtual restriction enzyme digest designed with DNA from the bacteriophage Kampy (isolated at W&M!) and the restriction enzymes BstXI, KpnI, and SfiI to resemble two bacteriophages. The chosen restriction enzymes were selected because they were in stock at William & Mary, had multiple cut sites in the Kampy DNA, and could be combined to make a design resembling a bacteriophage.

  • Week 3 HW: Lab Automation

    Python Script for Opentrons Artwork My Opentrons design is meant to resemble a frog because I use Xenopus laevis as my model organism in my honors thesis research at William & Mary. Post-Lab Questions Find and describe a published paper that utilizes the Opentrons or an automation tool to achieve novel biological applications. In Sanders et al., 2022, the researchers use an Opentron robot to optimize a bacterial whole-genome sequencing (WGS) protocol for gut microbiota samples. The Opentron was used for DNA extraction and library preparation steps, reducing the overall cost of WGS by ~$10 per genome and eliminating the need for 16S rRNA gene-based screening.

Subsections of Homework

Week 1 HW: Principles and Practices

Governance Assignment

Biological Engineering Application

Immunotherapies are a promising avenue in cancer treatment as they leverage the immune system’s innate ability to recognize and target non-self structures. However, traditional immunotherapies often result in on-target off-tumor effects, particularly in solid tumors. Synthetic biology has enabled new avenues of discovery to minimize this immunotherapy-related toxicity: engineering immune cells to target tumor-associated antigens (TAAs) or engineering genetic circuits to detect cancer disease signatures (Zhu et al., 2024). For example, modifying the traditional Chimeric Antigen Receptor (CAR) T-cell immunotherapy approach with a synthetic Notch (synNotch) receptor has demonstrated the ability to suppress off-target cytotoxicity related to organ rejection (Reddy et al., 2024) and selectively target cancerous cells in the central nervous system of mice rather than elsewhere in the body (Simic et al., 2024). Yet, while synNotch-modified CAR-T therapies show promise in their ability to reduce immunotherapy-related toxicity, additional research is needed to effectively administer these bioengineered cell systems in patients beyond pre-clinical experimentation.

Governance Goals

Goal 1: Perform rigorous pre-clinical testing to ensure new immunotherapies meet safety and efficacy standards before introducing into human patients.

Goal 2: Design ethical clinical trials with standardized eligibility, safety, and efficacy protocols with consideration for unique patterns of patient progression or response to treatment.

Goal 3: Create policies and organizations to promote equitable access to cancer prevention, screening, diagnosis, and immunotherapy resources to patients from diverse backgrounds and socioeconomic statuses across the globe.

Governance Actions

Option 1: Create an international organization to create global standards for immunotherapy clinical trial design and safety measures

  1. Purpose: Immunotherapy safety regulations are regulated at the national level, so efforts to promote global administration of novel cancer immunotherapies may experience roadblocks if national standards do not align. Establishing international safety and efficacy standards for immmunotherapy clinical trials will promote efficient administration of immunotherapy treatments across global lines.
  2. Design: An international healthcare organization, such as the WHO, must establish and agree upon an international standard for efficacy and safety in immunotherapy clinical trials. Then, all countries that participate in this organization must agree to the international standards to ensure ease of treatment deployment across global lines.
  3. Assumptions: This option assumes that international clinical trial standards will supercede any national guidelines, and that countries will be willing to adopt the international standard and/or deploy their immunotherapies in other countries.
  4. Risks of Failure and “Successes”: Establishing international immunotherapy clinical trial safety and efficacy guidelines may “fail” if the organization lacks the power to enforce the adoption of these guidelines across its participating countries. However, “success” of this option may delay the time it takes to put immunotherapies into clinical trials if international standards are incredibly restrictive and difficult to meet.

Option 2: Establish an international database to upload immunotherapy pre-clinical and clinical trial data

  1. Purpose: To create a centralized, accurate database with the safety and efficacy data for immunotherapies in pre-clinical and clinical trials adminsitered to diverse patient populations. This database will ultimately promote safer and more effective administration of immunotherapies as a large dataset is available for review.
  2. Design: Either an international healthcare organization (ex. WHO) or an independent organization would oversee the funding for the database and ensure the uploaded data is both reliable and accurate.
  3. Assumptions: This option would assume that immunotherapy administration can be standardized across diverse healthcare settings, particularly on the global scale. Additionally, creating a comprehensive and accessible database assumes that uploaded data is not subject to reportability bias.
  4. Risks of Failure and “Successes”: This measure would fail if the uploaded data is skewed toward well-funded research programs and not local healthcare systems with patients who experience barriers to immunotherapy access because this would not be a comprehensive dataset. However, if this measure is “successful”, immunotherapies with lower overall efficacy according to database metrics but high efficacy in a small patient population may be deprioritized or defunded.

Option 3: Establish an independent organization to increase access to preventative cancer screenings, diagnostic tools, and long-term care

  1. Purpose: Inadequate access to preventative cancer screenings (i.e. mammograms, pap smears, colonoscopies, etc.) as a result of financial, geographic, or other barriers leads to later diagnosis and poorer progonosis. As immunotherapies are most effective when treatment is begun at earlier stages of cancer progression, inadequate preventative measures undermine the innovative bioengineering design of novel immunotherapies. Establishing an organization to ensure equitable access to cancer screenings and diagnostic tools without financial barriers, both within the United States and abroad, will allow the advances of innovative immunotherapies to benefit more patients than just those with easy access to preventative measures.
  2. Design: As this organization would be independent of government funding, it would require public or philanthropic funding to decrease the cost barriers to preventative cancer screenings for patients with financial concerns. Additionally, the efforts of this organization would need to be integrated with healthcare systems on both the local and international scales to establish sites to receive preventative screenings and the capability to receive long-term follow-up care.
  3. Assumptions: This option relies on the assumption that patients whose cancer is detected by increased preventative measures will then be able to access the immunotherapy treatments that target their cancer.
  4. Risks of Failure and “Successes”: Without sufficient funding, this independent organization could ultimately shut down and fail in its mission to increase equiable access to preventative cancer screenings. Additionally, if the organization does not have reliable connections to local healthcare systems, its efforts to reduce cost barriers for patients seeking cancer screenings will not be realized. If this organization were to be “successful”, the influx of patients who are identified by screening measures may cause strain on the healthcare system.

Scoring Governance Actions

Does the option:Option 1Option 2Option 3
Enhance Biosecurity
• By preventing incidents211
• By helping respond222
Foster Lab Safety
• By preventing incident111
• By helping respond211
Protect the environment
• By preventing incidents111
• By helping respond111
Other considerations
• Minimizing costs and burdens to stakeholders222
• Feasibility?222
• Not impede research233
• Promote constructive applications333

Prioritization

I believe Option 3 should be prioritized. While innovative bioengineering applications to cancer immunotherapies are a promising avenue for decreasing cancer mortality both nationally and internationally, these efforts are in vain if they cannot be administered effectively in a large patient population. Increasing early detection of cancer by promoting equitable access to cancer screenings and diagnostic testing will ultimately increase the use of bioengineered immunotherapies as cancers detected at earlier stages are better candidates to be treated by immunotherapy approaches.

Week 2 Preparation

Professor Jacobson

  1. The error rate for a polymerase is 1 in 106 (1,000,000) bases. The human genome is 3x109 (3,000,000,000) base pairs in length, leading to an estimated 3,000 errors per replication of a human cell. Biology has processes in place, such as mismatch repair, capable of recognizing and excising these errors, then synthesizing the correct nucleotide.
  2. The genetic code is comprised of 64 distinct codons that encode 20 naturally-occuring amino acids. However, not all codons are used equally because each tRNA with an anticodon specified for a particular amino acid are not equally expressed in every organism.

Dr. LeProust

  1. Currently, the most commonly used method for oligo synthesis is phosphoramidite chemistry.
  2. Oligos longer than 200 bp have high error rates and high rates of decay.
  3. As a result of the high error rate and rates of decay, a 2000 bp gene synthesized via direct oligo synthesis would no longer resemble the desired sequence and would not encode the desired protein.

George Church

  1. The 10 essential amino acides are arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. These amino acids are not naturally synthesized in the human body and therefore must be consumed through the diet. The “Lysine Contingency” from Jurassic Park describes a genetic mutation introduced into the dinosaur enzyme for lysine synthesis as a means of protection from dinosaurs getting off the island (if the dinosaurs cannot synthesize an essential amino acid like lysine, they will not survive long). However, considering lysine is one of the amino acids that is solely ingested through the diet, the “Lysine Contingency” would not have any affect on dinosaurs because they should not have an enzyme responsible for lysine synthesis.

Website Preparation

I completed the setup of my personal HTGAA website, including adding my biography, contact information, and cover photo to my homepage.

Week 2 HW: DNA Read, Write, and Edit

Part 1: Benchling and In-silico Gel Art

Virtual Restriction Enzyme Digest Virtual Restriction Enzyme Digest

Virtual restriction enzyme digest designed with DNA from the bacteriophage Kampy (isolated at W&M!) and the restriction enzymes BstXI, KpnI, and SfiI to resemble two bacteriophages. The chosen restriction enzymes were selected because they were in stock at William & Mary, had multiple cut sites in the Kampy DNA, and could be combined to make a design resembling a bacteriophage.

Part 2: Restriction Digests and Gel Electrophoresis

Raw Gel Design Raw Gel Design Annotated Gel Design Annotated Gel Design

The imaged gel resembles the band lengths predicted by the virtual digest! While interpreting the gel image as two bacteriophages does require a bit of imagination, the digest was successful in that the true gel resembled the in silico prediction.

Part 3: DNA Design Challenge

3.1. Choose Your Protein

I chose the protein TTYH3 (tweety homolog 3) because it is the subject of my honors thesis research. ttyh3 encodes a calcium-dependent chloride channel and is a member of the tweety gene family- consisting of members ttyh1, ttyh2, and ttyh3- that is highly conserved across eukaryotes. ttyh3 is the least-characterized member of the tweety gene family, making it an intriguing subject of research. During neural development, the gene ttyh3 is primarily expressed in post-mitotic neurons. However, its precise function and role in neural development remain unknown. In my research, I aim to provide greater insight into the role of TTYH3 in neural development by overexpressing and knocking-out the ttyh3 gene in X. laevis and observing changes in expression of the downstream neural marker genes Sox2 and tubb2b.

Sequence from UniProt: MAGVSYAAPWWVSLLHRLPHFDLSWEATSSQFRPEDTDYQQALLLLGAAALACLALDLLFLLFYSFWLCCRRRKSEEHLDADCCCTAWCVIIATLVCSAGIAVGFYGNGETSDGIHRATYSLRHANRTVAGVQDRVWDTAVGLNHTAEPSLQTLERQLAGRPEPLRAVQRLQGLLETLLGYTAAIPFWRNTAVSLEVLAEQVDLYDWYRWLGYLGLLLLDVIICLLVLVGLIRSSKGILVGVCLLGVLALVISWGALGLELAVSVGSSDFCVDPDAYVTKMVEEYSVLSGDILQYYLACSPRAANPFQQKLSGSHKALVEMQDVVAELLRTVPWEQPATKDPLLRVQEVLNGTEVNLQHLTALVDCRSLHLDYVQALTGFCYDGVEGLIYLALFSFVTALMFSSIVCSVPHTWQQKRGPDEDGEEEAAPGPRQAHDSLYRVHMPSLYSCGSSYGSETSIPAAAHTVSNAPVTEYMSQNANFQNPRCENTPLIGRESPPPSYTSSMRAKYLATSQPRPDSSGSH

3.2. Reverse Translate: Protein Sequence to DNA Sequence

Using the “reverse translate” tool on bioinformatics.org, I generated the following nucleotide sequence from the TTYH3 amino acid sequence: atggcgggcgtgagctatgcggcgccgtggtgggtgagcctgctgcatcgcctgccgcattttgatctgagctgggaagcgaccagcagccagtttcgcccggaagataccgattatcagcaggcgctgctgctgctgggcgcggcggcgctggcgtgcctggcgctggatctgctgtttctgctgttttatagcttttggctgtgctgccgccgccgcaaaagcgaagaacatctggatgcggattgctgctgcaccgcgtggtgcgtgattattgcgaccctggtgtgcagcgcgggcattgcggtgggcttttatggcaacggcgaaaccagcgatggcattcatcgcgcgacctatagcctgcgccatgcgaaccgcaccgtggcgggcgtgcaggatcgcgtgtgggataccgcggtgggcctgaaccataccgcggaaccgagcctgcagaccctggaacgccagctggcgggccgcccggaaccgctgcgcgcggtgcagcgcctgcagggcctgctggaaaccctgctgggctataccgcggcgattccgttttggcgcaacaccgcggtgagcctggaagtgctggcggaacaggtggatctgtatgattggtatcgctggctgggctatctgggcctgctgctgctggatgtgattatttgcctgctggtgctggtgggcctgattcgcagcagcaaaggcattctggtgggcgtgtgcctgctgggcgtgctggcgctggtgattagctggggcgcgctgggcctggaactggcggtgagcgtgggcagcagcgatttttgcgtggatccggatgcgtatgtgaccaaaatggtggaagaatatagcgtgctgagcggcgatattctgcagtattatctggcgtgcagcccgcgcgcggcgaacccgtttcagcagaaactgagcggcagccataaagcgctggtggaaatgcaggatgtggtggcggaactgctgcgcaccgtgccgtgggaacagccggcgaccaaagatccgctgctgcgcgtgcaggaagtgctgaacggcaccgaagtgaacctgcagcatctgaccgcgctggtggattgccgcagcctgcatctggattatgtgcaggcgctgaccggcttttgctatgatggcgtggaaggcctgatttatctggcgctgtttagctttgtgaccgcgctgatgtttagcagcattgtgtgcagcgtgccgcatacctggcagcagaaacgcggcccggatgaagatggcgaagaagaagcggcgccgggcccgcgccaggcgcatgatagcctgtatcgcgtgcatatgccgagcctgtatagctgcggcagcagctatggcagcgaaaccagcattccggcggcggcgcataccgtgagcaacgcgccggtgaccgaatatatgagccagaacgcgaactttcagaacccgcgctgcgaaaacaccccgctgattggccgcgaaagcccgccgccgagctataccagcagcatgcgcgcgaaatatctggcgaccagccagccgcgcccggatagcagcggcagccat

3.3. Codon Optimization

Codon optimization is necessary because not all organisms use each codon with the same frequency due to differences in the abundance of various tRNAs, so optimizing the codons in the designed sequence will ideally increase the translational yield of my protein. I chose to optimize my sequence for X. laevis because that is the model organism in which I study the role of ttyh3 in neural development.

Using the Twist Bioscience Codon Optimization tool, I generated the following codon-optimized sequence: ATGGCTGGTGTGTCTTATGCTGCTCCTTGGTGGGTCTCTTTATTACATCGGTTGCCACACTTCGACCTCTCCTGGGAAGCCACATCTAGTCAATTCCGACCAGAGGACACAGACTACCAACAAGCACTATTATTGCTAGGGGCTGCCGCTTTAGCTTGTTTGGCTCTTGACCTTCTCTTCCTTTTGTTCTACTCTTTCTGGTTATGTTGTAGAAGAAGGAAGTCAGAGGAGCACCTCGACGCAGACTGTTGTTGTACTGCTTGGTGTGTCATAATCGCTACTCTTGTATGTTCAGCAGGTATAGCAGTAGGATTCTACGGGAATGGTGAGACATCCGACGGAATCCACCGGGCAACTTACTCCCTCAGACACGCTAATAGAACTGTTGCTGGTGTACAAGACCGGGTATGGGACACTGCAGTAGGGTTGAATCACACAGCAGAGCCTTCATTACAAACTTTAGAGAGACAACTTGCTGGAAGACCTGAGCCACTTAGAGCTGTTCAAAGATTACAAGGATTGTTAGAGACGCTCCTAGGGTACACTGCAGCCATCCCATTCTGGCGAAATACTGCCGTATCCTTAGAGGTACTCGCAGAGCAAGTTGACCTCTACGACTGGTACCGATGGCTTGGATACCTTGGGTTGTTGTTGTTGGACGTTATCATATGTTTACTCGTATTAGTTGGACTCATCAGGTCATCTAAGGGAATACTTGTTGGGGTTTGTTTACTTGGGGTTCTTGCTCTCGTCATCTCTTGGGGAGCATTGGGTCTTGAGCTTGCTGTTTCAGTAGGGTCAAGTGACTTCTGTGTAGACCCCGACGCCTACGTCACAAAGATGGTCGAGGAGTACTCAGTTCTTAGTGGAGACATCTTACAATACTACCTCGCTTGTTCACCAAGGGCAGCTAATCCCTTCCAACAAAAGCTTTCAGGTTCTCACAAGGCACTCGTAGAGATGCAAGACGTTGTCGCAGAGTTGCTTAGAACAGTTCCTTGGGAGCAACCAGCAACAAAGGACCCATTGCTCAGAGTCCAAGAGGTCCTTAATGGAACTGAGGTTAATCTCCAACACCTAACAGCCCTTGTAGACTGTCGATCACTCCACTTGGACTACGTCCAAGCTTTGACAGGTTTCTGTTACGACGGAGTTGAGGGTCTAATATACCTCGCCCTTTTCTCCTTCGTTACAGCTCTAATGTTCTCCAGTATCGTTTGTTCTGTTCCCCACACTTGGCAACAAAAGAGAGGACCCGACGAGGACGGAGAGGAAGAGGCAGCACCCGGTCCCAGACAAGCACACGACTCTTTGTACCGGGTCCACATGCCAAGTTTGTACTCATGTGGGTCTTCTTACGGTAGTGAGACAAGTATACCAGCCGCTGCCCACACTGTTTCTAATGCCCCCGTTACAGAGTACATGTCCCAAAATGCAAATTTCCAAAATCCCCGATGTGAGAATACGCCTTTGATAGGACGGGAGAGTCCCCCACCTTCATACACATCATCAATGAGGGCAAAGTACCTTGCAACATCACAACCCCGACCCGACTCCAGTGGATCACAC

3.4. You have a sequence! Now what?

To synthesize the ttyh3 mRNA and protein, I would use an in vitro transcription and translation kit (such as the ones produced by ThermoFischer) to synthesize ttyh3 mRNA and TTYH3 protein, respectively.

3.5. How does it work in nature/biological systems?

Single genes can produce multiple proteins at the transcriptional level through the process of alternative splicing. In eukaryotic cells, transcription and mRNA processing occurs in the nucleus whereas translation occurs in the cytoplasm. After mRNA is synthesized via transcription, mRNA processing (5’ cap addition, poly(A) tail addition, and intron splicing) occurs and exons (which make the coding region of the protein) are annealed together after introns are removed. However, the combinations of different exons (alternative splicing) can produce different proteins from the same primary (immature) mRNA transcript.

Part 4: Prepare a Twist DNA Synthesis Order

Plasmid Image Plasmid Image

Part 5: DNA Read/Write/Edit

5.1. DNA Read

  • What DNA would you want to sequence (e.g., read) and why? I would like to sequence the DNA of a tumor sample from a cancer in which ttyh3 is observed to be misregulated (i.e. HCC, genitourinary cancers, colorectal cancer, etc.). I would be interested to observe which mutations in ttyh3 gene lead to functional changes that promote tumorigenesis, tumor invasiveness, etc. and which changes have little to no impact.

  • In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why? I would use Illumina whole-genome sequencing (WGS), a second-generation sequencing method, because it is a relatively quick method of obtaining a base-by-base view of any single nucleotide variants (SNVs) in the genome which is essential information for understanding how mutations in the ttyh3 gene increase tumor proliferation, invaseiness, or aggression. The input for this sequencing is gDNA extracted from a tumor biopsy and prepared using the Illumina DNA Library Prep Kit. Following DNA extraction, the sample is sequenced using the “sequencing by synthesis” (SBS) technology which utilizes dNTPs bound to fluorescently-labeled reversible terminators to decode each base. The output of Illumina sequencing is a FASTQ file with quality scores.

5.2. DNA Write

  • What DNA would you want to synthesize (e.g., write) and why? Completely unrelated to my work with X. laevis, I think it would be fascinating to design a phage with a novel gene (or perhaps an entirely synthetic genome!). The protein structure could be predicted with a tool like AlphaFold, then the amino acid sequence could be reverse transcribed into cDNA for the gene of interest and integrated into a plasmid. As advancements in phage therapy show promise in combating antibiotic resistance, it would be fascinating to design a protein that would increase phage DNA replication, phage entry, etc. to increase the efficacy of the treatment.

  • What technology or technologies would you use to perform this DNA synthesis and why? First, and I don’t know if this is possible, I would create the desired 3D protein structure with a tool like AlphaFold and obtain the amino acid sequence. Then, similarly to this homework assignment, I would generate cDNA by reverse transcribing the AA sequence and order a plasmid from Twist (or elsewhere) with the gene of interest.

5.3. DNA Edit

  • What DNA would you want to edit and why? I would like to develop a technology to perform somatic editing of the DNA of individuals with genetic diseases that result from mutations in a single gene (i.e. Huntington’s, cystic fibrosis, etc.). While many similar technologies already exist and some clinical trials have shown promise (i.e. sickle cell anemia!), I would like to expand these technologies to other genetic diseases.

  • What technology or technologies would you use to perform these DNA edits and why? I would use CRISPR/Cas9-mediated homlogy directed repair to excise the mutated gene and replace it with a nonmutated, functional gene. This would involve design of the nonmutated gene and the sgRNA to direct the Cas9 enzyme to the appropriate cut site. The limitations of CRISPR/Cas9 technology are possible off-target effects (low precision) or the construct not being effectively delivered to all cells (low efficiency).

Week 3 HW: Lab Automation

Python Script for Opentrons Artwork

Opentrons Artwork Design Opentrons Artwork Design My Opentrons design is meant to resemble a frog because I use Xenopus laevis as my model organism in my honors thesis research at William & Mary.

Post-Lab Questions

  1. Find and describe a published paper that utilizes the Opentrons or an automation tool to achieve novel biological applications. In Sanders et al., 2022, the researchers use an Opentron robot to optimize a bacterial whole-genome sequencing (WGS) protocol for gut microbiota samples. The Opentron was used for DNA extraction and library preparation steps, reducing the overall cost of WGS by ~$10 per genome and eliminating the need for 16S rRNA gene-based screening.

  2. Write a description about what you intend to do with automation tools for your final project. My final project will likely involve the design of a genetic circuit whose expression is regulated by a synNotch system. As such, I could use the Opentron to automatize construction of my genetic circuit.

Final Project Ideas

For my final project, I am interested in engineering a synNotch-regulated circuit into Xenopus laevis, either to control cell-fate decisions or to control expression of a fluorescent protein to observe cell-cell communication during embryonic development. See my slide in the Committed Listener slide deck linked here.

Labs

Lab writeups:

  • Week 1 Lab: Pipetting

  • Week 2 Lab: DNA Gel Art

    Benchling Gel Design Restriction Digest Protocol Gel Preparation Protocol Gel Run and Imaging Protocol Final Gel Image

  • Week 3 Lab: Opentrons Art

    Opentrons Design Opentrons CoLab Code ### Green cursor = center_location.move(types.Point(x=-18, y = 12)) pipette_20ul.pick_up_tip() pipette_20ul.aspirate(15, location_of_color('Green')) dispense_and_detach(pipette_20ul, 3, cursor) cursor = cursor.move(types.Point(x=-4, y=4)) for i in range(4): dispense_and_detach(pipette_20ul, 3, cursor) if i!=3: cursor = cursor.move(types.Point(y=4)) pipette_20ul.aspirate(15, location_of_color('Green')) for i in range(2): cursor = cursor.move(types.Point(x=4, y=4)) dispense_and_detach(pipette_20ul, 3, cursor) cursor = cursor.move(types.Point(x=4)) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=4, y=-4)) pipette_20ul.aspirate(18, location_of_color('Green')) cursor = cursor.move(types.Point(x=4)) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=4, y=4)) cursor = cursor.move(types.Point(x=4)) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=4, y=-4)) pipette_20ul.aspirate(15, location_of_color('Green')) cursor = cursor.move(types.Point(y=-4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(y=-4)) cursor = cursor.move(types.Point(y=-4)) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=-4, y=-4)) cursor = cursor.move(types.Point(x=-4)) pipette_20ul.aspirate(18, location_of_color('Green')) for i in range(6): dispense_and_detach(pipette_20ul, 3, cursor) if i!=5: cursor = cursor.move(types.Point(x=-4)) cursor = cursor.move(types.Point(x=-4)) pipette_20ul.aspirate(15, location_of_color('Green')) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=-4, y=-4)) cursor = cursor.move(types.Point(y=-4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(y=-4)) cursor = cursor.move(types.Point(y=-4)) pipette_20ul.aspirate(15, location_of_color('Green')) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=4, y=-4)) cursor = cursor.move(types.Point(x=-12, y=16)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4)) cursor = cursor.move(types.Point(x=-4, y=-4)) pipette_20ul.aspirate(9, location_of_color('Green')) dispense_and_detach(pipette_20ul, 3, cursor) cursor = cursor.move(types.Point(y=-4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=4, y=-4)) cursor = cursor.move(types.Point(x=-4, y=-4)) pipette_20ul.aspirate(12, location_of_color('Green')) for i in range(4): dispense_and_detach(pipette_20ul, 3, cursor) if i!=3: cursor = cursor.move(types.Point(x=4)) cursor = cursor.move(types.Point(x=12)) pipette_20ul.aspirate(18, location_of_color('Green')) for i in range(6): dispense_and_detach(pipette_20ul, 3, cursor) if i!=5: cursor = cursor.move(types.Point(x=4)) cursor = cursor.move(types.Point(x=4)) pipette_20ul.aspirate(15, location_of_color('Green')) for i in range(3): dispense_and_detach(pipette_20ul, 3, cursor) if i!=2: cursor = cursor.move(types.Point(x=4, y=4)) cursor = cursor.move(types.Point(y=4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(y=4)) cursor = cursor.move(types.Point(y=4)) pipette_20ul.aspirate(15, location_of_color('Green')) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4, y=4)) cursor = cursor.move(types.Point(x=8, y=-8)) dispense_and_detach(pipette_20ul, 3, cursor) cursor = cursor.move(types.Point(x=4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=4, y=-4)) cursor = cursor.move(types.Point(y=-4)) pipette_20ul.aspirate(18, location_of_color('Green')) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4, y=-4)) cursor = cursor.move(types.Point(x=4, y=-4)) for i in range(4): dispense_and_detach(pipette_20ul, 3, cursor) if i!=3: cursor = cursor.move(types.Point(x=-4)) pipette_20ul.drop_tip() pipette_20ul.pick_up_tip() ### Red cursor = cursor.move(types.Point(x=-8, y=44)) pipette_20ul.aspirate(12, location_of_color('Red')) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4)) cursor = cursor.move(types.Point(y=4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=4)) cursor = cursor.move(types.Point(x=-24)) pipette_20ul.aspirate(12, location_of_color('Red')) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4)) cursor = cursor.move(types.Point(y=-4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=4)) cursor = cursor.move(types.Point(x=4, y=-8)) pipette_20ul.aspirate(18, location_of_color('Red')) for i in range(4): dispense_and_detach(pipette_20ul, 3, cursor) if i!=3: cursor = cursor.move(types.Point(x=4)) cursor = cursor.move(types.Point(x=-4, y=-4)) for i in range(2): dispense_and_detach(pipette_20ul, 3, cursor) if i!=1: cursor = cursor.move(types.Point(x=-4)) pipette_20ul.drop_tip()

Subsections of Labs

Week 1 Lab: Pipetting

cover image cover image

Week 2 Lab: DNA Gel Art

Benchling Gel Design

VirtualDigestGelDesign VirtualDigestGelDesign

Restriction Digest Protocol

Gel Preparation Protocol

Gel Run and Imaging Protocol

Final Gel Image

Week 3 Lab: Opentrons Art

Opentrons Design

OpentronsDesign OpentronsDesign

Opentrons CoLab Code

 ### Green
  cursor = center_location.move(types.Point(x=-18, y = 12))

  pipette_20ul.pick_up_tip()

  pipette_20ul.aspirate(15, location_of_color('Green'))
  dispense_and_detach(pipette_20ul, 3, cursor)

  cursor = cursor.move(types.Point(x=-4, y=4))

  for i in range(4):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=3:
      cursor = cursor.move(types.Point(y=4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  for i in range(2):
    cursor = cursor.move(types.Point(x=4, y=4))
    dispense_and_detach(pipette_20ul, 3, cursor)

  cursor = cursor.move(types.Point(x=4))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=4, y=-4))

  pipette_20ul.aspirate(18, location_of_color('Green'))

  cursor = cursor.move(types.Point(x=4))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=4, y=4))

  cursor = cursor.move(types.Point(x=4))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=4, y=-4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  cursor = cursor.move(types.Point(y=-4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(y=-4))

  cursor = cursor.move(types.Point(y=-4))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=-4, y=-4))

  cursor = cursor.move(types.Point(x=-4))

  pipette_20ul.aspirate(18, location_of_color('Green'))

  for i in range(6):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=5:
      cursor = cursor.move(types.Point(x=-4))

  cursor = cursor.move(types.Point(x=-4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=-4, y=-4))

  cursor = cursor.move(types.Point(y=-4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(y=-4))

  cursor = cursor.move(types.Point(y=-4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=4, y=-4))

  cursor = cursor.move(types.Point(x=-12, y=16))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4))

  cursor = cursor.move(types.Point(x=-4, y=-4))

  pipette_20ul.aspirate(9, location_of_color('Green'))

  dispense_and_detach(pipette_20ul, 3, cursor)

  cursor = cursor.move(types.Point(y=-4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=4, y=-4))

  cursor = cursor.move(types.Point(x=-4, y=-4))

  pipette_20ul.aspirate(12, location_of_color('Green'))

  for i in range(4):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=3:
      cursor = cursor.move(types.Point(x=4))

  cursor = cursor.move(types.Point(x=12))

  pipette_20ul.aspirate(18, location_of_color('Green'))

  for i in range(6):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=5:
      cursor = cursor.move(types.Point(x=4))

  cursor = cursor.move(types.Point(x=4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  for i in range(3):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=2:
      cursor = cursor.move(types.Point(x=4, y=4))

  cursor = cursor.move(types.Point(y=4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(y=4))

  cursor = cursor.move(types.Point(y=4))

  pipette_20ul.aspirate(15, location_of_color('Green'))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4, y=4))

  cursor = cursor.move(types.Point(x=8, y=-8))

  dispense_and_detach(pipette_20ul, 3, cursor)

  cursor = cursor.move(types.Point(x=4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=4, y=-4))

  cursor = cursor.move(types.Point(y=-4))

  pipette_20ul.aspirate(18, location_of_color('Green'))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4, y=-4))

  cursor = cursor.move(types.Point(x=4, y=-4))

  for i in range(4):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=3:
      cursor = cursor.move(types.Point(x=-4))

  pipette_20ul.drop_tip()
  pipette_20ul.pick_up_tip()

  ### Red
  cursor = cursor.move(types.Point(x=-8, y=44))

  pipette_20ul.aspirate(12, location_of_color('Red'))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4))

  cursor = cursor.move(types.Point(y=4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=4))

  cursor = cursor.move(types.Point(x=-24))

  pipette_20ul.aspirate(12, location_of_color('Red'))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4))

  cursor = cursor.move(types.Point(y=-4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=4))

  cursor = cursor.move(types.Point(x=4, y=-8))

  pipette_20ul.aspirate(18, location_of_color('Red'))

  for i in range(4):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=3:
      cursor = cursor.move(types.Point(x=4))

  cursor = cursor.move(types.Point(x=-4, y=-4))

  for i in range(2):
    dispense_and_detach(pipette_20ul, 3, cursor)
    if i!=1:
      cursor = cursor.move(types.Point(x=-4))

  pipette_20ul.drop_tip()

Subsections of Projects

Individual Final Project

cover image cover image

Group Final Project

cover image cover image