Phase 5: Cassette Design & Twist Bioscence Preparation
Cassette Architecture & Synthesis Preparation:
Cassette Architecture Design
Each expression cassette was designed using the same general architecture: Promoter → AMV Enhancer → Chloroplast Transit Peptide (CTP) → CODH Gene → Tag (if applicable) → Terminator
All seven cassettes were designed individually in Benchling before being assembled into the larger Structural and Maturation multicassette constructs.
Selection of Regulatory and Functional Elements
- Promoter–Terminator Combinations
The promoter–terminator pairs selected during the previous phase were incorporated into the final cassette designs to drive constitutive expression in tobacco cells. Different promoter strengths were intentionally distributed across the genes to maintain balanced expression between structural and maturation proteins.
- AMV RNA4 Translational Enhancer
Each cassette included the modified AMV RNA4 translational enhancer immediately downstream of the promoter. The endogenous ATG codon was previously removed from the enhancer sequence to ensure that translation initiates only at the intended chloroplast transit peptide start codon.
This enhancer was incorporated to improve ribosome recruitment and increase translational efficiency of the engineered mRNAs.
- Chloroplast Transit Peptides (CTPs)
Because the CODH pathway must function inside chloroplasts, chloroplast transit peptides were fused upstream of each CODH coding sequence. These CTPs act as molecular targeting signals directing the newly synthesized proteins from the cytoplasm into the chloroplast after translation. Different transit peptides were selected based on predicted compatibility and chloroplast import efficiency.
- CODH Gene Fusion
Each codon-optimized CODH gene was fused directly downstream of its corresponding chloroplast transit peptide in order to generate a continuous translational fusion protein.
This design ensures that the targeting peptide is translated first and recognized by the chloroplast import machinery before cleavage by stromal processing peptidase (SPP).
- Epitope Tag Integration
Specific epitope tags were incorporated into selected cassettes to facilitate downstream protein detection, purification, and complex characterization. The following tags were used: FLAG tag for coxL and coxD; His tag for coxS
These tags were included to support future protein purification, Co-IP experiments, PAGE analysis, and enzyme characterization workflows during the experimental validation phase.
Final Cassette Components
The final regulatory combinations and chloroplast targeting peptides used for each cassette are summarized below.
| Gene | Promoter | CTP Source | Terminator | Tag |
|---|---|---|---|---|
| coxL | D100 | RbcS | tOCS | FLAG |
| coxM | SM | Fer2 | tHSP18.2 | — |
| coxS | FMV 34S | RecA | tATPase | His |
| coxD | D100 | RbcS | tOCS | FLAG |
| coxE | SM | Fer2 | tHSP18.2 | — |
| coxF | S100 | RecA | tATPase | — |
| coxG | FMV 34S | RbcS | T-35S | — |
The objective of this step was to design each cox gene as an independent plant expression cassette containing all the required regulatory elements for efficient expression in Nicotiana tabacum. This included selecting appropriate promoters, terminators, chloroplast transit peptides (CTPs), translational enhancers, purification tags, and spacer sequences, while organizing the multicassette constructs in a modular format compatible with DNA synthesis and Gibson Assembly.
Vector Linearization and Homology Arm Design:
Before assembling the large Structural and Maturation multicassette inserts, the next objective was to identify suitable insertion sites within the pCAMBIA backbones and generate homology arms compatible with Gibson Assembly.
This step was essential to ensure seamless integration of the final multicassette constructs into the plant transformation vectors.
Selection of the Restriction Site
To determine the optimal vector opening site, the multiple cloning site (MCS) maps of both pCAMBIA1300 and pCAMBIA2300 were analyzed in Benchling.
The restriction enzymes previously excluded during gene and cassette design (“Clean List”) were cross-referenced against the vector maps to avoid conflicts with internal restriction sites present in the final constructs.
Following this analysis, XbaI was selected as the universal linearization site for both vectors because:
- It was absent from the designed multicassette inserts
- It produced a clean single-cut linearization
- It was positioned appropriately within the MCS regionIt simplified downstream Gibson Assembly design
Both pCAMBIA vectors were virtually digested in Benchling using XbaI:
- pCAMBIA2300 → designated for the Structural multicassette
- pCAMBIA1300 → designated for the Maturation multicassette
This generated linearized vector backbones with defined left and right insertion junctions.
Homology Arm Design
To enable Gibson Assembly, homology arms were generated directly from the terminal sequences of the XbaI-linearized vectors.
For each construct, 40 bp regions located at the ends of the digested vectors were extracted and incorporated as terminal overlaps (“tails”) on the outer fragments of the multicassette inserts.
These homology arms provide complementary regions between the vector backbone and the insert, allowing seamless enzymatic assembly during Gibson Assembly.
Because both vectors were linearized at the same XbaI site, the resulting homology arms were identical for the two constructs.
Final Homology Arms
Left Homology Arm : gaccatgattacgaattcgagctcggtacccggggatcct
Right Homology Arm: ctagagtcgacctgcaggcatgcaagcttggcactggccg
These sequences were directly extracted from the terminal regions of the XbaI-digested pCAMBIA vectors after virtual linearization in Benchling.
The objective of this step was to prepare the pCAMBIA2300 and pCAMBIA1300 backbones for Gibson Assembly by virtually linearizing the vectors at a selected restriction site and generating homologous overlap regions. These homology arms were designed to guide the precise insertion and seamless assembly of the multicassette fragments into the plasmid backbones.
Twist Fragment Preparation & Troubleshooting:
After finishing the design of all seven expression cassettes in Benchling, I prepared the sequences for synthesis by Twist Bioscience. The objective of this step was to divide the large multicassette constructs into smaller DNA fragments compatible with DNA synthesis and Gibson Assembly.
Initially, I tried to submit each complete fragment directly to the Twist synthesis platform. Although several fragments were accepted immediately, others were rejected because the algorithm detected highly repetitive DNA regions.
The major problem came from the synthetic promoters D100 and S100, which contain repeated enhancer motifs. Repetitive DNA is problematic for commercial DNA synthesis because it can:
- Reduce synthesis accuracy
- Increase recombination risks
- Create instability during cloning
- Interfere with sequence assembly algorithms
To solve these issues, I performed several optimization and troubleshooting steps directly in Benchling.
Fragment A
Fragment A was designed for the structural multicassette construct cloned into the pCAMBIA2300 backbone.
This fragment initially contained: [Left Homology Arm] – [Spacer 1] – [coxL Cassette] – [40 bp Spacer 2]
The fragment was rejected by the Twist algorithm because the D100 promoter contained two repeated enhancer regions.
To solve this issue, I first tried to identify the functional transcription factor binding regions inside the promoter sequence. Using the promoter map from the original publication, I localized the consensus sequences (functional boxes) and carefully avoided modifying them.
I then introduced small nucleotide substitutions only in the non-functional repeated regions. The modifications included: A ↔ T, G ↔ C substitutions
I specifically used complementary substitutions in order to maintain approximately the same GC content and preserve promoter stability.
These modifications reduced the number of repeated regions detected by Twist, but the fragment was still rejected.
I also tried to optimize the repeated region located near the end of the coxL cassette. Several synonymous sequence modifications were tested: GGAGAGCAACTTGGACTT→ GGTGAACAGCTGGGTTTG→ GGCGAGCAACTTGGACTT→ GGAGAACAGCTCGGCTTG
However, the Twist algorithm continued detecting problematic repeats.
- Final Solution: Fragment Splitting
Since sequence optimization alone was insufficient, I decided to split Fragment A into two smaller fragments, A1 and A2.
The objective was to physically separate the repeated enhancer regions of the D100 promoter into different synthesis fragments.
After splitting the construct, both fragments were accepted successfully by Twist Bioscience without additional problems.
Final Fragment Design
Fragment A1 : [Left Homology Arm] – [Spacer 1] – [First Part of D100]
- Fragment A2 : [40 bp overlap from A1] – [Remaining D100 region + Full coxL cassette] – [40 bp Spacer 2]
I added a 40 bp overlap between A1 and A2 to allow seamless Gibson Assembly during the final plasmid construction.
Fragment B was accepted directly by the Twist algorithm without requiring any optimization. This fragment contained: [Spacer 2] – [Full coxM Cassette] – [Spacer 3]
The fragment already satisfied all synthesis requirements because it did not contain repetitive regions or problematic GC-rich structures. This overlap design ensured proper assembly continuity during Gibson Assembly.
Fragment C was also accepted directly without major issues. This fragment contained: [Last 40 bp of Spacer 3] – [Full coxS Cassette] – [Right Homology Arm]
The fragment was designed to terminate the structural multicassette assembly inside the pCAMBIA2300 backbone.
This organization ensured proper circularization of the final plasmid during Gibson Assembly.
- Fragment D
Fragment D belonged to the maturation multicassette construct cloned into pCAMBIA1300. Initially, the fragment contained: [Left Homology Arm] – [Spacer 1] – [coxD Cassette] – [Spacer 2]
Like Fragment A, this fragment was rejected because the D100 promoter contained repeated enhancer regions detected by the Twist algorithm. Instead of modifying the sequence extensively, I decided to split the fragment into two smaller fragments. The objective was again to physically separate the repeated promoter regions.
Final Fragment Design
Fragment D1: [Left Homology Arm] – [Spacer 1] – [First Part of D100]
- Fragment D2: [40 bp overlap from D1] – [Rest of D100 + Full coxD cassette] – [Spacer 2]
I introduced 40 bp overlaps between the fragments to allow Gibson Assembly reconstruction of the complete cassette. After splitting, both fragments were accepted successfully by Twist Bioscience.
Fragment E was accepted directly without requiring optimization. This fragment contained:[Last 40 bp of Spacer 2] – [coxG Cassette] – [Spacer 3]
I designed the overlaps carefully to maintain assembly continuity with the neighboring fragments. The fragment did not contain problematic repeats or synthesis instability regions.
Fragment F contained: [Last 40 bp of Spacer 3] – [coxE Cassette] – [Spacer 4]
Unlike the previous problematic fragments containing the D100 or S100 promoters, this fragment used the SM promoter, which did not contain repetitive enhancer regions.
Therefore, Fragment F was accepted directly by the Twist Bioscience algorithm from the first submission without requiring any optimization, sequence modification, or fragment splitting.
The fragment was synthesized as a complete cassette exactly as originally designed in Benchling.
- Fragment G
Fragment G corresponded to the coxF cassette region.
Initially, I designed the complete coxF cassette as a single large fragment containing the S100 promoter. However, the Twist algorithm rejected the sequence because the S100 promoter contained repetitive enhancer regions similar to those previously observed with the D100 promoter.
To solve this problem, I divided the large region into multiple smaller fragments. Some fragments were accepted immediately, while the fragment containing the S100 promoter continued to fail.Therefore, I followed the same strategy previously used for the D100 promoter.
First, I localized the functional consensus regions inside the S100 promoter using the original promoter publication.
Then, I introduced minimal nucleotide substitutions only outside the functional boxes: A ↔ T, G ↔ C substitutions
These modifications preserved: GC content balance, Promoter architecture, Functional regulatory motifs
After these adjustments, the fragment was finally accepted by the Twist algorithm. Fragment G corresponded to the coxF cassette region. Initially, I designed the fragment as a single large sequence, but the S100 promoter repeats again caused synthesis rejection.
To solve this issue, I split the region into two smaller fragments:
- Fragment G1: [First 40 bp of Spacer 4] – [First Part of coxF Cassette]
- Fragment G2: [40 bp overlap from G1] – [Remaining coxF Cassette] – [Right Homology Arm]
The 40 bp overlap allowed seamless Gibson Assembly between both fragments. After splitting and promoter optimization, both fragments were accepted successfully.
Final twist validated fragments:
| Fragment | Construct | Main Components | Special Notes |
|---|---|---|---|
| A1 | Structural construct (pCAMBIA2300) | Left homology arm + Spacer 1 + First part of D100 promoter | Fragment created after splitting Fragment A to separate repeated enhancer regions |
| A2 | Structural construct (pCAMBIA2300) | 40 bp overlap from A1 + Remaining D100 promoter + Complete coxL cassette + First 40 bp of Spacer 2 | Accepted after promoter splitting |
| B | Structural construct (pCAMBIA2300) | Spacer 2 + Complete coxM cassette + Spacer 3 | Accepted directly without optimization |
| C | Structural construct (pCAMBIA2300) | Last 40 bp of Spacer 3 + Complete coxS cassette + Right homology arm | Accepted directly without optimization |
| D1 | Maturation construct (pCAMBIA1300) | Left homology arm + Spacer 1 + First part of D100 promoter | Generated after splitting Fragment D to separate repeated promoter regions |
| D2 | Maturation construct (pCAMBIA1300) | 40 bp overlap from D1 + Remaining D100 promoter + Complete coxD cassette + Spacer 2 | Accepted after fragment splitting |
| E | Maturation construct (pCAMBIA1300) | Last 40 bp of Spacer 2 + Complete coxG cassette + Spacer 3 | Accepted directly without optimization |
| F | Maturation construct (pCAMBIA1300) | Last 40 bp of Spacer 3 + Complete coxE cassette + Spacer 4 | Contains SM promoter; accepted directly from the first submission |
| G1 | Maturation construct (pCAMBIA1300) | First 40 bp of Spacer 4 + First part of coxF cassette | Fragment generated after splitting the coxF region because of S100 promoter repeats |
| G2 | Maturation construct (pCAMBIA1300) | 40 bp overlap from G1 + Remaining coxF cassette + Right homology arm | Accepted after S100 promoter optimization and fragment splitting |
The objective of this step was to adapt the designed multicassette constructs to the synthesis requirements of Twist Bioscience by identifying and resolving problematic repetitive regions, optimizing synthesis compatibility, and ensuring that all final fragments could be successfully synthesized and assembled through Gibson Assembly.