Projects

Final projects:

  • Wet-lab: In-person run protocols Remote Opentrons based Gingko Nebula Cloud Competent e.coli Cloning transformation kit Plating media (LB) Antibiotic selection marker Adhesion protein binding peptide / cardiac junction protein PC12 - enhance dopaminic thing or find disease what would cells secret with dopamine? How to do read out?
    Synaptic dopamine release is positively regulated by SNAP-25 that involves in benzo[a]pyrene-induced neurotoxicity https://www.sciencedirect.com/science/article/abs/pii/S0045653519315991?via%3Dihub this paper confirms that DRD1 and DRD3 are endogenously expressed in PC12 and co-localise with SNAP-25, and that CRISPR-Cas9 plasmid transfection works effectively in these cells using Lipofectamine 2000 — directly relevant to your BSL-1 modification approach. The SNAP-25/DRD interaction also suggests that if you’re overexpressing DRD1 for your reinforcement system, SNAP-25 expression levels will influence how effectively that receptor gets trafficked

Subsections of Projects

Group Final Project

cover image cover image

Individual Final Project

Presentation Slide Presentation Slide

Wet-lab:

  1. In-person run protocols
  2. Remote Opentrons based
  3. Gingko Nebula Cloud

Competent e.coli Cloning transformation kit Plating media (LB) Antibiotic selection marker

Adhesion protein binding peptide / cardiac junction protein

PC12 - enhance dopaminic thing or find disease what would cells secret with dopamine? How to do read out? \

Synaptic dopamine release is positively regulated by SNAP-25 that involves in benzo[a]pyrene-induced neurotoxicity https://www.sciencedirect.com/science/article/abs/pii/S0045653519315991?via%3Dihub this paper confirms that DRD1 and DRD3 are endogenously expressed in PC12 and co-localise with SNAP-25, and that CRISPR-Cas9 plasmid transfection works effectively in these cells using Lipofectamine 2000 — directly relevant to your BSL-1 modification approach. The SNAP-25/DRD interaction also suggests that if you’re overexpressing DRD1 for your reinforcement system, SNAP-25 expression levels will influence how effectively that receptor gets trafficked

The role of the dopamine D1 receptor in social cognition: studies using a novel genetic rat model doi:10.1242/dmm.024752

Drd1 dopamine receptor D1 [ Rattus norvegicus (Norway rat) ] https://www.ncbi.nlm.nih.gov/gene/24316

ComponentBSL statusNotesPC12 Adh cellsBSL-1Rat, non-human, non-primateNGF proteinBSL-1Recombinant protein, no pathogen riskpcDNA3.1 plasmidBSL-1Non-replicating in mammalian cells, no viral genesDRD1 insertBSL-1Normal rat receptor gene, not a pathogen or toxinLipofectamine 2000BSL-1Chemical transfection reagentDopamine/adenosineBSL-1Standard lab chemicalsHA tagBSL-1Small peptide epitope, inert
The one thing to flag with your institution: any plasmid transfection technically requires IBC (Institutional Biosafety Committee) notification at most universities, even at BSL-1. It's usually a simple form, not a full review. Check with your UAL/UCL biosafety officer before starting — it protects you.

Drafting your Twist order — step by step

Step 1: Find the rat DRD1 coding sequence
Go to NCBI Gene database:

Search: "Drd1 Rattus norvegicus"
You want gene ID: 24316
Click through to the RefSeq mRNA record: NM_012546
This gives you the full mRNA — you need the CDS (coding sequence) only, which is the region between the start codon (ATG) and stop codon

The rat DRD1 CDS encodes a 446 amino acid protein. Copy the CDS nucleotide sequence — this is your starting material.

Step 2: Add the HA tag sequence
You're adding a small epitope tag to the N-terminus of DRD1 so you can verify membrane insertion later (as in the Homberg paper).
The HA tag sequence is: TACCCATACGATGTTCCAGATTACGCT
This encodes the peptide: YPYDVPDYA
You insert this immediately after the start ATG and before the DRD1 coding sequence, with a short glycine-serine linker between them to avoid disrupting folding:
Structure of your final insert:
ATG - HA tag - GGS linker - DRD1 CDS (minus its own ATG)
The GGS linker in DNA is: GGCGGCTCC
So your insert reads:
ATG [HA] GGCGGCTCC [DRD1 CDS from codon 2 onward]

Step 3: Codon optimise for rat
Take your assembled insert sequence and run it through a codon optimisation tool. The best free option is:
Integrated DNA Technologies (IDT) codon optimisation tool

Go to: idtdna.com/CodonOpt
Paste your sequence
Select organism: Rattus norvegicus
Export the optimised sequence

This ensures the synthetic gene is expressed efficiently in your rat PC12 cells. The optimised sequence will look different from the natural sequence at the nucleotide level but encode exactly the same protein.

Step 4: What exactly to order from Twist
You need one construct — a complete circular plasmid. Specifically:
Twist product type: Gene Fragment cloned into expression vector, or full plasmid synthesis
Ask Twist to deliver: pcDNA3.1(+) containing your insert
Your insert from 5' to 3':
[Kozak sequence] - ATG - [HA tag] - [GGS linker] - [Codon-optimised rat DRD1 CDS] - [Stop codon]
The Kozak sequence goes right before your ATG to ensure efficient translation initiation in mammalian cells: GCCACCATG (the ATG is your start codon)
So the full insert order is:
GCCACC - ATG - TACCCATACGATGTTCCAGATTACGCT - GGCGGCTCC - [DRD1 codons 2-446] - TGA
Flanking this, the pcDNA3.1 vector provides:

CMV promoter (upstream)
BGH polyA signal (downstream)
Ampicillin resistance (for bacterial propagation)
Neomycin/G418 resistance (for mammalian selection if needed)


Step 5: Also order a control plasmid
You need one additional construct — same vector, same promoter, but replace the DRD1-HA insert with EGFP.
This gives you:

Visual confirmation that transfection worked (green cells)
A matched negative control for all your cAMP and electrophysiology assays
Something to optimise your Lipofectamine conditions against before using your precious DRD1 plasmid

Twist sells a standard EGFP insert — you can often just specify "pcDNA3.1-EGFP" as a catalogue item rather than custom synthesis.

Summary of what you're ordering
OrderConstructPurpose#1 (custom)pcDNA3.1-CMV-HA-DRD1 (codon optimised rat)Your experimental construct#2 (standard)pcDNA3.1-CMV-EGFPTransfection control
That's it — just two plasmids to start. Once you've validated membrane insertion and functional cAMP response with construct #1, you have everything you need to run the Opentrons RL experiment.

Practical next steps right now

Go to NCBI, pull NM_012546, copy the CDS
Manually add the Kozak + HA + linker to the 5' end
Run through IDT codon optimisation
Submit to Twist as a full plasmid order in pcDNA3.1(+)
Notify your IBC in parallel

https://www.ncbi.nlm.nih.gov/nuccore/NM_012546

>lcl|NM_012546.3_cds_NP_036678.3_1 [gene=Drd1] [db_xref=GeneID:24316,RGD:2518] [protein=D(1A) dopamine receptor] [protein_id=NP_036678.3] [location=439..1779] [gbkey=CDS]
ATGGCTCCTAACACTTCTACCATGGATGAGGCCGGGCTGCCAGCGGAGAGGGATTTCTCCTTTCGCATCC
TCACGGCCTGTTTCCTGTCACTGCTCATCCTGTCCACTCTCCTGGGCAATACCCTTGTCTGTGCGGCCGT
CATCCGGTTTCGACACCTGAGGTCCAAGGTGACCAACTTCTTTGTCATCTCTTTAGCTGTGTCAGATCTC
TTGGTGGCTGTCCTGGTCATGCCCTGGAAAGCTGTGGCCGAGATTGCTGGCTTTTGGCCCTTTGGGTCCT
TTTGTAACATCTGGGTAGCCTTTGACATCATGTGCTCTACGGCGTCCATTCTGAACCTCTGCGTGATCAG
CGTGGACAGGTACTGGGCTATCTCCAGCCCTTTCCAGTATGAGAGGAAGATGACCCCCAAAGCAGCCTTC
ATCCTGATTAGCGTAGCATGGACTCTGTCTGTCCTTATATCCTTCATCCCAGTACAGCTAAGCTGGCACA
AGGCAAAGCCCACATGGCCCTTGGATGGCAATTTTACCTCCCTGGAGGACACCGAGGATGACAACTGTGA
CACAAGGTTGAGCAGGACGTATGCCATTTCATCGTCCCTCATCAGCTTTTACATCCCCGTAGCCATTATG
ATCGTCACCTACACCAGTATCTACAGGATTGCCCAGAAGCAAATCCGGCGCATCTCAGCCTTGGAGAGGG
CAGCAGTCCATGCCAAGAATTGCCAGACCACCGCAGGTAACGGGAACCCCGTCGAATGCGCCCAGTCTGA
AAGTTCCTTTAAGATGTCCTTCAAGAGGGAGACGAAAGTTCTAAAGACGCTGTCTGTGATCATGGGGGTG
TTTGTGTGCTGCTGGCTCCCTTTCTTCATCTCGAACTGTATGGTGCCCTTCTGTGGCTCTGAGGAGACCC
AGCCATTCTGCATCGATTCCATCACCTTCGATGTGTTTGTGTGGTTTGGGTGGGCGAATTCTTCCCTGAA
CCCCATTATTTATGCTTTTAATGCTGACTTCCAGAAGGCGTTCTCAACCCTCTTAGGATGCTACAGACTC
TGCCCTACTACGAATAATGCCATAGAGACGGTGAGCATTAACAACAATGGGGCTGTGGTGTTTTCCAGCC
ACCATGAGCCCCGAGGCTCCATCTCCAAGGACTGTAATCTGGTTTACCTGATCCCTCATGCCGTGGGCTC
CTCTGAGGACCTGAAGAAGGAAGAGGCTGGTGGAATAGCTAAGCCACTGGAGAAGCTGTCCCCAGCCTTA
TCGGTCATATTGGACTATGACACCGATGTCTCTCTAGAAAAGATCCAACCTGTCACACACAGTGGACAGC
ATTCCACTTGA
[Kozak] - [ATG] - [HA tag] - [GGS linker] - [rDrd1 CDS] - [TGA stop]
Kozak sequence (GCCACC)
A short regulatory signal immediately before the start codon. Ribosomes use it to recognise exactly where to begin reading and making protein. Without it expression is poor.
ATG start codon
Every protein begins here. The ribosome reads this and starts building the amino acid chain.
HA epitope tag (YPYDVPDYA)
A tiny peptide tag borrowed from the influenza virus surface protein. Completely inert in your system. Its only purpose is to give you something to detect with an anti-HA antibody — so you can confirm your DRD1 protein is being made and has reached the cell membrane correctly.
GGS flexible linker
Three small amino acids (Glycine-Glycine-Serine) acting as a molecular spacer between the HA tag and DRD1. Prevents the tag from physically interfering with DRD1 folding and membrane insertion.
Rat DRD1 coding sequence
The actual gene — 1338 nucleotides encoding 446 amino acids of the dopamine D1 receptor. This is the functional part. Codon optimised for efficient expression in rat PC12 cells.
TGA stop codon
Tells the ribosome to stop. Protein synthesis ends here.

pcDNA3.1 - CMV - HA - rDrd1 - coopt
    │         │     │     │       │
    │         │     │     │       └── Codon optimised for rat PC12
    │         │     │     └────────── Rat Dopamine D1 Receptor gene
    │         │     └──────────────── HA detection tag
    │         └────────────────────── Strong mammalian promoter
    └──────────────────────────────── Vector backbone

circular DNA plasmid with Cytomegalovirus (CMV) promoter that drives high level expression of DRD1 gene in mammalian cell. HA tag is borrowed from influenza virus to act as molecular flag on DRD1 protein so i can detect with an anti-HA antibody. Codon optimized via Twist