Homework

Weekly homework submissions:

  • Week 1 HW: Principles and Practices

    Question 1: A biologically engineered application that I find particularly compelling is the development of gene editing tools for biodiversity conservation. Given the rapid global decline of many species driven by human activity, emerging infectious diseases, and climate change, preserving biodiversity and maintaining ecosystem stability has become an urgent scientific and societal challenge. One promising application of genetic engineering in this context is the germline editing of amphibian genomes to combat the chytrid fungus, Batrachochytrium dendrobatidis, which has caused widespread population declines and driven numerous frog and toad species toward extinction.

  • Week 2 HW: DNA Read, Write, Edit

    Week 2 Pre-Lecure Homework: Homework Questions from Professor Jacobson: Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome. How does biology deal with that discrepancy? DNA polymerase makes about 1 error per 10⁴ bases during replication. Since the human genome is about 3 billion base pairs, this would result in roughly 300,000 errors per replication if left uncorrected. Biology handles this through proofreading and DNA repair systems, which dramatically reduce the final number of mistakes.

Subsections of Homework

Week 1 HW: Principles and Practices

cover image cover image

Question 1:

A biologically engineered application that I find particularly compelling is the development of gene editing tools for biodiversity conservation. Given the rapid global decline of many species driven by human activity, emerging infectious diseases, and climate change, preserving biodiversity and maintaining ecosystem stability has become an urgent scientific and societal challenge. One promising application of genetic engineering in this context is the germline editing of amphibian genomes to combat the chytrid fungus, Batrachochytrium dendrobatidis, which has caused widespread population declines and driven numerous frog and toad species toward extinction.

Chytrid infects amphibians through the skin, where it disrupts essential physiological functions including osmoregulation, cutaneous gas exchange, and electrolyte balance, often resulting in cardiac arrest and death. Notably, certain amphibian species and populations exhibit natural resistance or tolerance to infection. I would begin by studying these resistant taxa to identify antifungal genes and immune pathways that are differentially expressed and to determine the molecular mechanisms by which resistance is conferred.

Using this information, I would develop a targeted gene editing strategy, most likely using CRISPR based tools, to introduce resistance associated alleles into the germline of chytrid susceptible species. Edited individuals would then be raised and monitored in controlled captive environments to assess disease resistance, overall fitness, reproductive success, and potential off target effects across multiple generations. Only after rigorous validation would these individuals be considered for carefully regulated reintroduction into natural habitats. If successful, this approach could enable the spread of chytrid resistance through vulnerable populations and contribute to the recovery of amphibian species and the ecosystems they support.

Question 2:

To ensure that germline gene editing for amphibian conservation contributes to an ethical future, a central governance goal must be the prevention of harm while enabling responsible intervention in biodiversity crises. Because releasing genetically edited organisms into the wild introduces permanent and potentially far-reaching changes, policy frameworks must prioritize ecological safety, long-term accountability, and proportional use of the technology. Ethical governance with this technology should aim to ensure that interventions are scientifically justified and carefully controlled, without halting innovation outright.

One key policy objective is ecological and biological safety. This includes requiring extensive pre-release testing of edited amphibians across multiple generations in captivity to evaluate fitness, behavior, reproduction, and unintended physiological effects beyond disease resistance. In addition, governance frameworks should mandate ecological risk assessments that examine how chytrid-resistant individuals might alter ecosystem dynamics or pathogen evolution, including the possibility of selecting for more virulent fungal strains. Policies should also require clear containment and mitigation strategies prior to release, such as geographically limited trials or genetic mechanisms that reduce the risk of uncontrolled spread.

Another major governance goal is strong oversight and accountability. Decisions about releasing gene-edited organisms should be evaluated by independent, interdisciplinary review bodies that include not only molecular biologists, but also ecologists, ethicists, conservation practitioners, and representatives of local or Indigenous communities. Clear legal responsibility must be established for long-term monitoring and potential ecological harm, recognizing that unintended consequences may arise years or decades after release. Because amphibians and pathogens frequently cross political borders, international coordination will also be necessary to prevent unilateral actions that could impact shared ecosystems.

Ethical governance must also address proportionality and justice. Gene editing should be framed as a last-resort conservation tool, deployed only when less invasive strategies (such as habitat protection, captive breeding, or antifungal treatments) have proven insufficient. Each proposed intervention should be evaluated on a species-by-species basis, taking into account ecological role, conservation status, and cultural significance. Finally, long-term monitoring and adaptive governance should be mandatory, treating gene-edited conservation organisms as an ongoing responsibility rather than a one-time solution. By embedding safety, transparency, and equity into policy from the outset, conservation gene editing can be developed as an ethical and legitimate response to the accelerating loss of global biodiversity.

Question 3:

One potential governance action is the creation of a mandatory staged release regulatory framework for gene edited conservation organisms, overseen by federal environmental regulators in coordination with academic researchers. Currently, conservation gene editing proposals fall into regulatory gray areas and are often evaluated under frameworks designed for agriculture or laboratory research rather than irreversible ecological interventions. This proposal would introduce a formal, stepwise approval process similar to phased clinical trials, requiring progression from laboratory validation to contained semi natural environments, then to limited field trials, and only then to broader release. To work effectively, this system would require regulators such as the U.S. Fish and Wildlife Service or equivalent international bodies to develop species specific guidelines, while researchers and institutions opt in by designing studies that meet these staged criteria. This approach assumes that ecological risks can be meaningfully assessed at each stage and that regulators have sufficient expertise and funding to evaluate complex genetic and ecological data. A major risk of failure is regulatory bottlenecking, as overly slow or conservative approvals could delay interventions until species are already extinct. Conversely, a successful rollout could unintentionally normalize gene editing as a default conservation tool, reducing investment in habitat protection or other non genetic solutions.

A second governance action involves the use of funding based incentives and requirements, driven by public research funders and philanthropic conservation organizations. At present, much conservation biotechnology research is funded without standardized requirements for long term ecological monitoring or community engagement. Under this approach, funders would require applicants working on chytrid resistant amphibians to commit to extended post release monitoring, open data sharing, and collaboration with local stakeholders as conditions of grant funding. This is analogous to how clinical research increasingly ties funding to transparency and post market surveillance. For this strategy to work, funding agencies must be willing to allocate resources not only for innovation but also for long term monitoring, and researchers must accept longer timelines and broader accountability. This approach assumes that financial leverage is sufficient to shape researcher behavior and that public or nonprofit funders remain dominant actors in this space. Risks include the possibility that private actors bypass these norms entirely or that monitoring requirements become superficial compliance exercises rather than meaningful safeguards. If highly successful, this action could also skew research toward species or regions that are easier to monitor, leaving the most vulnerable ecosystems under served.

A third governance action is the development of technical safeguards embedded directly into gene editing designs, pursued primarily by academic laboratories and biotechnology companies but guided by regulatory expectations. Rather than relying solely on policy restrictions, researchers would be encouraged or required to design edits that limit spread or persistence, such as conditional gene expression, geographically constrained release strategies, or inheritance patterns that reduce uncontrolled dissemination. Making this approach effective would require advances in genetic engineering tools, agreement on acceptable design standards, and regulatory recognition of these safeguards as meaningful risk reduction measures. This strategy assumes that ecological complexity can be partially managed through genetic design and that engineered constraints will function as intended in natural environments. Failure could occur if these safeguards break down under natural selection, mutation, or environmental variability. Even apparent success carries risks, as confidence in technical controls could lead regulators or researchers to underestimate broader ecological uncertainties and create a false sense of security around releases that remain fundamentally irreversible.

Together, these governance actions, including regulatory staging, funding based incentives, and built in technical safeguards, illustrate how ethical oversight of chytrid focused conservation gene editing can be distributed across multiple actors and mechanisms. Rather than relying on a single authority or rule, this approach acknowledges uncertainty, spreads responsibility, and attempts to balance urgency with caution to combat accelerating amphibian decline.

Question 4:

Does This Option:Option 1Option 2Option 3
Enhance Biosecurity
• By preventing incidents121
• By helping respond213
Foster Lab Safety
• By preventing incident212
• By helping respond213
Protect the environment
• By preventing incidents121
• By helping respond213
Other considerations
• Minimizing costs and burdens to stakeholders322
• Feasibility?213
• Not impede research211
• Promote constructive applications211

Question 5:

Based on the scoring across biosecurity, environmental protection, feasibility, and impact on research, I would prioritize a combined governance approach centered on funding based incentives and requirements, complemented by a staged release regulatory framework, with embedded technical safeguards treated as a supporting rather than primary control. This recommendation is aimed primarily at national environmental regulators and public research funders, such as the U.S. Fish and Wildlife Service, the National Science Foundation, and equivalent agencies internationally. Together, these actors are well positioned to shape researcher behavior, ensure ecological responsibility, and maintain scientific momentum in conservation gene editing.

Funding based incentives emerge as the strongest foundational governance option because they score highly on feasibility, responsiveness, and their ability to promote constructive applications without excessively impeding research. Tying grant funding to long term ecological monitoring, transparency, and stakeholder engagement allows governance to operate early in the research lifecycle while remaining flexible across species and ecosystems. This approach also scales well internationally and avoids the delays associated with creating entirely new regulatory regimes. However, this strategy assumes that public and philanthropic funders remain influential in conservation biotechnology and that compliance requirements are meaningfully enforced rather than treated as procedural formalities.

The staged release regulatory framework should function as a second layer of governance, particularly at the point of environmental release, where irreversible ecological risks are highest. While this option imposes higher costs and may slow deployment, its strong performance in preventing environmental harm justifies its use at later stages rather than as a blanket constraint on early research. A key trade off here is timing. Overly conservative approvals could delay intervention beyond the point where species recovery is feasible, yet insufficient oversight risks ecological damage that cannot be reversed. This framework also depends on the assumption that regulators have adequate expertise, funding, and legal authority to evaluate gene edited organisms in ecological rather than agricultural contexts. Embedded technical safeguards should be encouraged but not relied upon as the primary governance mechanism. While they score highly in preventing incidents and promoting innovation, they perform poorly in response capacity and carry substantial uncertainty under real world ecological conditions. Natural selection, mutation, or environmental variability may erode designed constraints over time. Treating technical safeguards as a supplement or last resort rather than a substitute for oversight avoids the risk of false confidence and maintains institutional responsibility for long term outcomes.

Overall, this layered governance strategy reflects an assumption that no single tool can adequately manage the uncertainty inherent in releasing gene edited organisms into complex ecosystems. By prioritizing funding based governance to shape norms and practices, reserving regulatory staging for high risk transitions, and supporting technical safeguards as risk reducing features, policymakers can balance urgency with caution. This approach accepts trade offs in speed and cost in exchange for legitimacy, adaptability, and long term ecological responsibility in the use of gene editing for amphibian conservation.

Sources:

Lips, K. R. 2016, December 5. Overview of chytrid emergence and impacts on amphibians. U.S. National Library of Medicine. https://pmc.ncbi.nlm.nih.gov/articles/PMC5095542/.

What role does regulation play in biotechnology?. 1970, January 1. . https://climate.sustainability-directory.com/question/what-role-does-regulation-play-in-biotechnology/.

Week 2 HW: DNA Read, Write, Edit

Week 2 Pre-Lecure Homework:

Homework Questions from Professor Jacobson:

  1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome. How does biology deal with that discrepancy?

DNA polymerase makes about 1 error per 10⁴ bases during replication. Since the human genome is about 3 billion base pairs, this would result in roughly 300,000 errors per replication if left uncorrected. Biology handles this through proofreading and DNA repair systems, which dramatically reduce the final number of mistakes.

  1. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest?

Because 61 codons code for 20 amino acids, there are many possible DNA sequences that can encode the same protein. In reality, not all work well due to factors like tRNA availability, mRNA structure, and protein folding during translation, which affect how efficiently and accurately a protein is made.

Sources: ChatGPT Prompt: “Detail the most common different factors in which variant amino acid codes may fail and explain each”

ChatGPT Prompt: “How does biology deal with the error rate of DNA polymerase on a molecular level?”

Homework Questions from Dr. LeProust:

Most common oligo synthesis method: The most widely used method is solid-phase synthesis using phosphoramidite chemistry.

Why are oligos longer than ~200 nt hard to make? Errors build up during synthesis, making long sequences increasingly inaccurate.

Why can’t a 2000 bp gene be made directly? The error rate becomes too high, so genes are instead built from shorter oligos that are assembled together.

Homework Question from George Church:

The ten essential amino acids in animals are phenylalanine, valine, threonine, tryptophan, isoleucine, methionine, histidine, arginine, leucine, and lysine.

Because animals must get all of these from their diet, the “lysine contingency” proposed in Jurassic Park is not a strong safety mechanism as limiting lysine alone would not effectively control an organism.

Week 2 Homework

1. Benchling & In-silico Gel Art

cover image cover image

I made the letter M! (I grew up in Michigan, Go Blue!)

2. Gel Art - Restriction Digests and Gel Electrophoresis

cover image cover image

I ran a gel in lab! I pipetted DNA into 10 wells, only 1 band shows up clearly besides the ladder, but there are a couple of fainter bands as well.

3. DNA Design Challenge

3.1: I chose the protein Magainin-2, an antimicrobial peptide isolated from the skin of the African Clawed Frog, Xenopus Laevis. I thought this would be an interesting protein to study because of its antibiotic properties and possible function as a resistance to chytrid fungus in amphibians.

Amino Acid Sequence: GIGKFLHSAKKFGKAFVGEIMNS

3.2:

reverse translation of Untitled to a 69 base sequence of most likely codons. ggcattggcaaatttctgcatagcgcgaaaaaatttggcaaagcgtttgtgggcgaaatt atgaacagc

3.3: Codon Optomization

Here is the optomized sequence using Xenopus Laevis as my chosen model organism.

cover image cover image

Here is the sequence using E.coli as the model organism for codon optomization: GGCATTGGCAAATTTCTGCATAGCGCGAAAAAATTTGGCAAAGCGTTTGTGGGCGAAATTATGAACAGC

E.Coli would be preferable to create this protein in for ease-of-use, widespread availability, and fast growth.

3.4 You Have A Sequence! Now What?

To synthesize a protein from this sequence, a common method used is cell-dependent, where I create a plasmid vector that includes a promoter, ribosome-binding sequence, my sequence, a terminator, and possibly a selection marker that helps verify that the plasmid is being expressed (such as an antibiotic resistance sequence). The plasmid can then be transformed into a host organism such as a bacteria or yeast, via electroporation or heat shock. The sequence is now able to express my protein!

4. Prepare a Twist DNA Synthesis Order

Here is my Twist - generated plasmid in Benchling. My coding sequence was short, so I had to add in a neutral regulatory element upstream of my coding region so I had enough BP for Twist to generate the rest of the plasmid.

cover image cover image

5. DNA Read/Write/Edit

5.1: If I were to sequence and read any DNA, I would love to read a full genome of an extinct species that still has available tissue for ancient DNA sequencing. It would be interesting to compare the genome of these extinct species to their closest relatives and see what genes are conserved and how they differ genetically. This would give some insight into the evolutionary history behind the speciation of that particular lineage and could give clues on how to safely and ethically bring back the species from extinction if it would help a current ecosystem ecologically.

5.2: