FINAL PROJECT

Bacillus subtilis as a PAH Degrading & Visual Bioremediation Paint

cover image cover image image reference: Amir Goldbourt (2019). Structural characterization of bacteriophage viruses by NMR. Progress in Nuclear Magnetic Resonance Spectroscopy, 114-115, pp.192–210. doi:https://doi.org/10.1016/j.pnmrs.2019.06.004.

Initial Interest

My project grew out of a particular interest in Bacillus subtilis, which I first explored during a previous biodesign group project. In that work, we investigated soil-dwelling bacteria and their benefits for both soil health and human wellbeing, and used this research to develop an educational game kit designed to teach children about the importance of caring for soil.

cover image cover image

Initial group project with fellow biodesign students: Luiggi Marresse, Qian Qian Yutoung Hou, Christine Xiaoyan Weng, sparked my interest in the potential health benefits of bacteria, more specifically, Bacillus subtilis.

Research Development
1.Coming across using Bacillus Subtilis as a paint for bioremediation

While exploring ideas for my HTGAA final project, I took a closer interest in these bacteria and came across the paper “The Utilization of Bacillus subtilis to Design Environmentally Friendly Living Paints with Anti-Mold Properties” (Yuval et al., 2024). Because the study focused on exterior applications, I began to question how such a paint would perform in outdoor conditions and what additional capabilities this bacterium might offer as a bioremediative agent. This led me to a broader body of research examining its potential to degrade volatile organic compounds (VOCs), particularly polycyclic aromatic hydrocarbons (PAHs).

Reference: Yuval Dorfan, Avichay Nahami, Morris, Y., Shohat, B. and Kolodkin-Gal, I. (2024). The Utilization of Bacillus subtilis to Design Environmentally Friendly Living Paints with Anti-Mold Properties. Microorganisms, 12(6), pp.1226–1226.

The following are some of my key findings whilst extending my research:

Paper: Bacillus subtilis as a powerful weapon in the removal of environmental pollutants

  • Baciullus subtilitis: non-pathogenic Gram-positive bacterium
  • Renowned as the second most studied microorganism after Escherichia coli
  • Contributes significantly to the biodegradation of organic pollutants.
  • According to the United Nations' 2030 Agenda for Sustainable Development, beneficial microbes are key tools for removing environmental contaminants and controlling plant diseases under the "One Health" framework (Sarrocco, 2023; Lee et al., 2023).
  • Low molecular weight aromatic compounds (LMW - subset of PAH’s, 2-3 aromatic rings vs HMW PAHS have more than 4)
  • Among polycyclic aromatic hydrocarbons, benzo[a]pyrene (BaP) and phenanthrene (PHE) have attracted significant attention due to their notable carcinogenicity, and have been classified by the International Agency for Research on Cancer (IARC) as Group 1 and Group 3 carcinogens.
  • Both BaP and PHE, with their fused aromatic rings, are highly stable and resistant to biodegradation. However, B. subtilis has shown impressive abilities in its degradation.

    • Reference: Liu, M., Chen, W.-J., Si, G., Yan, C., Song, H., Mishra, S., Ghorab, M.A. and Chen, S. (2025). Bacillus subtilis as a powerful weapon in the removal of environmental pollutants. Journal of Environmental Management, 396, p.127894. doi:https://doi.org/10.1016/j.jenvman.2025.127894.

    Paper: Enzymatic Pathways and Mechanisms of Polycyclic Aromatic Hydrocarbon (PAH) Degradation by Bacillus subtilis

  • PAHs: Organic pollutants made of fused aromatic rings, formed mainly by incomplete combustion (coal, oil, gas, biomass) and industrial activity.
  • Structural diversity: Range from simple 2-ring compounds (e.g., naphthalene) to complex 3+ ring PAHs (e.g., anthracene, phenanthrene).
  • Biodegradability: Low-molecular-weight (LMW) PAHs are more biodegradable; high-molecular-weight (HMW) PAHs are more persistent → initial focus on LMW, extend to HMW in later work.
  • Key challenge: PAH degradation can produce toxic intermediates → toxicity assays are needed to ensure safe and complete bioremediation (biosafety consideration).
  • Health risks: PAHs are toxic, mutagenic, and carcinogenic (e.g., benzo[a]pyrene); exposure occurs via inhalation, ingestion, or skin contact and is linked to respiratory disease and cancer.
  • Why Bacillus subtilis: Non-pathogenic and safe, capable of degrading multiple PAHs (including some HMW), genetically tractable for enhancing degradation efficiency.
  • Pseudomonas spp.: Highly adaptable degraders, carry PAH-degrading genes on plasmids (enabling horizontal transfer), produce enzymes like dioxygenases to break down a wide range of PAHs.
  • B. subtilis BMT4i: Degrades benzo[a]pyrene via chromosomally encoded genes, meaning the genes responsible for this function are integrated into the bacterium’s chromosome rather than carried on plasmids. This was confirmed through experiments demonstrating that removing plasmids had no impact on BaP degradation.

    • Enzymatic Pathways and Mechanisms of Polycyclic Aromatic Hydrocarbon (PAH) Degradation by Bacillus subtilis

  • Enzymatic capability: Bacillus subtilis can degrade PAHs using multiple enzymes, though full pathways are not yet fully understood.
  • Initial oxidation: Dioxygenases and monooxygenases add hydroxyl groups to PAH rings, starting the breakdown process.
  • Intermediate conversion: Dehydrogenases convert dihydrodiols into diols, helping stabilise and further process intermediates.
  • Ring cleavage: Ring-cleaving dioxygenases break aromatic rings via ortho- or meta-cleavage pathways.
  • Catechol breakdown: Catechol-degrading enzymes process intermediates formed after ring cleavage.
  • Additional enzymes: Likely includes lignin peroxidase and cytochrome P450 monooxygenases, similar to other PAH-degrading microbes.
  • Knowledge gap: Exact degradation pathways in B. subtilis remain incompletely characterised and require further research.

    • Reference:Nayra Niño (2024). Review Paper: Bacillus subtilis BMT4i a Bioremediation Agent for High-Molecular-Weight PAH…. [online] Medium. Available at: https://medium.com/insights-of-nature/review-paper-bacillus-subtilis-bmt4i-a-bioremediation-agent-for-high-molecular-weight-pah-f62438f1c574 [Accessed 2 Mar. 2026].

    Paper:Degradation of Benzo [a] Pyrene by a novel strain, Bacillus subtilis BMT4i (MTCC 9447)

  • Unlike prior studies, where BaP degradation occurred only co-metabolically in the presence of additional carbon sources, BMT4i efficiently utilised BaP as its sole carbon source.
  • Highlights the adaptability of BMT4i, which can also degrade other polycyclic aromatic hydrocarbons (PAHs) such as naphthalene, anthracene, and dibenzothiophene.

    • Reference:Lily, M.K., Bahuguna, A., Dangwal, K. and Garg, V. (2009). Degradation of Benzo [a] Pyrene by a novel strain Bacillus subtilis BMT4i (MTCC 9447). Brazilian Journal of Microbiology, 40(4), pp.884–892. doi:https://doi.org/10.1590/s1517-83822009000400020.

    Future Applications / Research Gap based on literature review:

    1. Toxicity & safety assessment
  • Analyse the toxicity of metabolites formed during PAH degradation.
  • Ensure breakdown products are less harmful than parent compounds.
  • Incorporate toxicity assays as part of biosafety evaluation.
    1. Mineralisation studies
  • Determine whether B. subtilis can fully mineralise PAHs (e.g., pyrene, benzo[a]pyrene).
  • Assess conversion into harmless end products (CO₂ and H₂O).
    1. Metabolic pathway elucidation
  • Identify enzymes and pathways involved in PAH degradation.
  • Address the current lack of fully characterised pathways.
  • Improve understanding of degradation mechanisms.
    1. Environmental stability
  • Evaluate long-term performance of B. subtilis in contaminated environments.
  • Assess reliability and consistency under real-world conditions.
    1. Genetic optimisation
  • Address gap: Most studies focus on natural degradation capacity.
  • Use genetic engineering to enhance PAH degradation efficiency.
  • Upregulate or introduce key degradation genes.
  • Modify metabolic pathways to improve enzyme activity.
  • Enable breakdown of more complex (HMW) PAHs.
    • Project Proposal Slide: First Draft
    cover image cover image

    Specific Enzyme Research

    I furthered my research to identify the specific enzymes that Bacillus subtilis has that have been studied for their ability to degrade PAH. Through this research, I found two key enzymes:

    Enzyme 1: polycyclic aromatic hydrocarbon ring-hydroxylating dioxygenase alpha subunit, partial [Bacillus sp. SB26]

    Paper reference: Bhatt, K.K., Lily, M.K., Joshi, G. and Dangwal, K. (2018a). Benzo(a)pyrene degradation pathway in Bacillus subtilis BMT4i (MTCC 9447). Turkish Journal of Biochemistry, 43(6), pp.693–701. doi:https://doi.org/10.1515/tjb-2017-0334.

    Enzyme 2: Laccase CotA

    Paper reference: NPU CHINA (2022). | NPU-CHINA - iGEM 2022. [online] Igem.wiki. Available at: https://2022.igem.wiki/npu-china/design#gene [Accessed 2 Mar. 2026].

    quote from reference: "One study found that laccase CotA from Bacillus subtilis exhibit a higher laccase-specific activity than laccase CueO from Escherichia coli, indicating that CotA is a better candidate for the remediation of PAHs than CueO. This is why we chose laccase cotA from Bacillus subtilis as a member of the ligninolytic enzymes system in our project."

    After further research into the individual enzymes, I chose to focus on the CotA laccase due to the stronger body of literature and the number of projects developing plasmid constructs incorporating this enzyme for the bioremediation of PAHs. In addition, E. coli is widely used as a model organism in laboratory settings, and as I was the only in-person student at Lifefabs aiming to explore expression directly in Bacillus subtilis, this provided a practical and well-supported alternative. Previous studies have successfully expressed CotA laccase in E. coli strains, reinforcing its suitability for this approach.

    Sequence of Bacillus subtilis strain WD23 laccase (cotA) gene, complete cds (1542bp):

    atgacacttg aaaaatttgt ggatgctctc ccaatcccag atacactaaa gccagtacag caatcaaaag aaaaaacata ctacgaagtc accatggaag aatgcactca tcagctccat cgcgatctcc ctccaacccg cctgtgggga tacaacggct tatttccggg gccgaccatt gaggttaaaa gaaatgaaaa cgtatatgta aaatggatga ataaccttcc ttccacacat ttccttccga ttgatcacac cattcatcac agtgacagcc agcatgaaga gcccgaggta aagactgttg ttcatttaca cggcggcgtc acgccagatg acagtgacgg gtatccggag gcttggtttt ccaaagactt tgaacaaaca ggaccttatt tcaaaagaga ggtttatcat tatccaaacc agcagcgcgg ggctatattg tggtatcacg atcacgccat ggcgctcacc aggctaaatg tctatgccgg acttgtcggt gcttatatca ttcatgaccc aaaggaaaaa cgcttaaaac tgccttcaga cgaatacgat gtgccgcttc ttatcacaga ccgcacgatc aatgaggacg gttctttgtt ttatccaagc gcaccggaaa acccttctcc gtcactgcct aatccttcaa tcgttccggc tttttgcgga gaaaccatac tcgtcaacgg gaaggtatgg ccatacttgg aagtcgagcc aaggaaatac cgattccgtg tcatcaacgc ctccaataca agaacctata acctgtcact cgataatggc ggagagttta ttcagattgg ttcagatgga gggctcctgc cgcgatctgt taaactgaat tctttcagcc ttgcgcctgc tgaacgttat gatatcatca ttgacttcac agcatatgaa ggagaatcga tcattttggc aaacagcgcg ggctgcggcg gtgacgtcaa tcctgaaaca gatgcgaata tcatgcaatt cagagtcaca aaaccattgg cacaaaaaga cgaaagcaga aagccgaagt acctcgcctc atacccttcg gtacagcatg aaagaataca aaacatcaga acgttaaaac tggcaggcac ccaggacgaatacggcagac ccgtccttct gcttaataac aaacgctggc acgatcccgt cacagaagca ccaaaagtcg gcacaactga aatatggtcc attatcaacc ccacacgcgg aacacatccgatccacctgc atctagtctc cttccgtgta ttagaccggc ggccgtttga tatcgcccgttatcaagaaa gcggggaatt gtcatatacc ggtccggctg tcccgccgcc gccaagtgaaaaaggctgga aagacaccat tcaagcgcat gcaggtgaag tcctgagaat cgcggcgacattcggtccgt acagcggacg atacgtatgg cattgccata ttctagagca tgaagactatgacatgatga gaccgatgga tataactgat ccccataaataa

  • Uniprot page: https://www.uniprot.org/uniprotkb/H8WGE7/entry

  • Uniprot page: https://www.uniprot.org/uniprotkb/H8WGE7/entry