Week 2 DNA Read, Write and Edit

Assignment 2

I created a Benchling account, loaded up the Lambda DNA, and then tried different combinations of the following restriction enzymes.

• EcoRI
• HindIII
• BamHI
• KpnI
• EcoRV
• SacI
• SalI

I note that the Automation Art tools produces randomly created electrophoresis ladders, but I excluded Ndel, Pvull and Xhol - because they were not in the list we were supposed to use.

I found it difficult to produce virtual digest ladders that could be combined into recognisable artistic shapes. To get an idea of the range of possible patterns, I systematically looked at choosing combinations of 1, 2, 3, 4 and 5 enzymes.

I’ll include some examples of this brute force way of assessing potential patterns. But that didn’t work well. So I widened my enzyme list to include the enzyme Pvull as well. I ended up with this pattern:

Part 3: DNA Design Challenge

3.1 I’ve chosen the sequence for staphyloxanthin, the protein found in the bacteria Staphylococcus aureus that creates a deep yellow colour that might be similar to the chrome yellow pigment van Gogh used to paint the centres of his sunflowers in the ‘Sunflowers’ painting hanging in the National Gallery.

3.2 Reverse translate

I found the Uniprot entry for 4,4’-diapophytoene synthase, which is used in the biosynthesis of the yellow-orange carotenoid staphyloxanthin. In Benchling, I imported an AA sequence and specified ‘A9JQL9’ and ‘Uniprot’ to import from a database. I selected the entire protein sequence, right-clicked and clicked ‘Backtranslate’. From there, I obtained this DNA Sequence:

ATGACTATGATGGATATGAATTTCAAATATTGTCATAAAATAATGAAAAAACACAGTAAAAGTTTCTCTTATGCCTTTGATTTACTTCCAGAAGACCAAAGAAAGGCTGTATGGGCAATTTATGCAGTTTGTCGCAAAATTGATGACTCAATAGATGTTTATGGTGACATTCAATTTTTAAATCAAATAAAGGAAGATATTCAATCTATAGAAAAATATCCATACGAATATCATCATTTTCAAAGTGATAGAAGAATTATGATGGCACTACAGCACGTGGCTCAACATAAAAATATTGCTTTCCAGAGCTTTTATAATCTTATTGATACCGTCTATAAAGATCAACATTTTACAATGTTTGAAACTGATGCGGAGTTATTCGGATATTGCTATGGTGTTGCTGGTACAGTTGGTGAAGTCTTAACACCTATCTTATCAGATCATGAAACGCATCAAACATATGACGTGGCGCGTCGTCTTGGAGAATCATTGCAATTAATTAATATTTTAAGAGATGTAGGCGAGGATTTTGAAAATGAACGTATTTACTTTTCAAAACAACGACTAAAACAATATGAGGTAGATATTGCTGAAGTTTATCAAAATGGGGTAAACAACCATTATATTGATTTATGGGAATATTACGCAGCAATCGCAGAAAAAGATTTTCGAGATGTTATGGATCAAATTAAAGTATTTTCTATTGAAGCACAACCTATAATAGAACTCGCCGCACGTATCTATATCGAAATATTAGATGAAGTTAGACAAGCTAATTATACTTTGCACGAAAGAGTATTTGTGGAAAAACGTAAGAAAGCTAAGTTATTTCATGAGATTAATTCGAAATACCATAGGATT