Filling in the Twist Order for Final Project

My Steps for Filling out a Twist Order

I determined all the parts of the insert sequence:

Promoter: BBa_K1231000 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgaca

RBS: CATTAAAGAGGAGAAAGGTACC

Start Codon: ATG

Coding Sequence: Borrowing example from the Homework Week 2 AGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAA

7x His Tag: CATCACCATCACCATCATCAC

Stop Codon: TAA

Terminator: Borrowing example from Homework Week 2 CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA

I concatenated them together to create the insert sequence

cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgacaCATTAAAGAGGAGAAAGGTACCATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAACATCACCATCACCATCATCACTAACCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA

I pasted the insert sequence into Benchling’s ‘Bases’ field. Also specify a linear sequence. Pasting entire insert sequence into Benchling Pasting entire insert sequence into Benchling

I went through and annotated every part of the concatenated sequence (e.g. annotations for Promoter, RBS, etc.) Annotate all the parts of the insert sequence: Promoter (Pasr), RBS, Start Codon, Coding Sequence (sfGTP), 7x His Tag, Stop Codon, Terminator (BBa_B0016) Annotate all the parts of the insert sequence: Promoter (Pasr), RBS, Start Codon, Coding Sequence (sfGTP), 7x His Tag, Stop Codon, Terminator (BBa_B0016) After I finished annotating all the parts, I exported the sequence so that the insert sequence can be loaded into Twist. After finishing annotation, export sequence After finishing annotation, export sequence I chose FASTA as the file format for the exported sequence. Export the sequence as a FASTA file Export the sequence as a FASTA file The generated FASTA file looks like this: The resulting FASTA file looks like this The resulting FASTA file looks like this I opened the Twist application Go to the Twist application Go to the Twist application I chose ‘Clonal genes’ because I’m going to clone genes from cell plasmids. Select Clonal genes Select Clonal genes Then I uploaded the FASTA file I exported from Benchling. Upload the FASTA file I exported from Benchling Upload the FASTA file I exported from Benchling Once the FASTA file was uploaded, Twist made it appear as a valid sequence. The FASTA file should then appear as having been uploaded The FASTA file should then appear as having been uploaded I clicked on the sequence. Click on the imported sequence Click on the imported sequence I chose the vector for the plasmid and selected the option for resistance markers for chloramphenicol rather than ampicillin Select the vector for the plamid. Include resistance markers for chloramphenicol rather than ampicillin Select the vector for the plamid. Include resistance markers for chloramphenicol rather than ampicillin After I selected the vector, the sequence for the plasmid was ready to download. I downloaded the plasmid sequence as a Genbank file. I would later upload this into Benchling to see the plasmid map. Download the generated Genbank file for the plasmid that now includes the insertion sequence Download the generated Genbank file for the plasmid that now includes the insertion sequence The generated Genbank file looks like this. The Genbank file looks like this The Genbank file looks like this Note that the Twist application now shows a cost estimate for the plasmid. Twist will show a cost estimate Twist will show a cost estimate I switched back to Benchling and imported the Genbank file. Go back to Benchling to import the plasmid sequence described by the Genbank file Go back to Benchling to import the plasmid sequence described by the Genbank file No errors were encountered. Benchling will indicate that no errors were encountered during the import Benchling will indicate that no errors were encountered during the import Here is the final plasmid model. Final plasmid map with the insert sequence Final plasmid map with the insert sequence