Individual Final Project

HTGAA 2026: Individual Final Project Documentation

Project Title

Bio-Acoustics: Lab-Grown Spider Silk Instruments


SECTION 1: ABSTRACT

This project focuses on designing a recombinant spider-silk-inspired protein that could be expressed, purified, concentrated, and spun into a synthetic fiber. Spider silk is an important biomaterial because it combines strength, elasticity, toughness, and low density. These properties make it useful for many possible applications, including textiles, biodegradable fibers, medical materials, lightweight structural materials, and acoustic materials.

The broad objective of this project is to design a mini-spidroin DNA construct that preserves some of the core sequence logic of spider silk while remaining small enough to synthesize and analyze in a class-scale setting. I hypothesized that a short repeat-rich protein containing alanine-rich and glycine-rich domains could produce a silk-like material in which alanine-rich regions contribute strength and glycine-rich regions contribute flexibility.

The main completed outcome was a 476 bp DNA construct containing a T7 promoter, ribosome binding site, start codon, spider-silk-inspired repetitive coding region, C-terminal 6xHis purification tag, and double stop codon. Translation from the first start codon produced a continuous 146 amino acid mini-spidroin-like protein with no premature stop codons before the final termination sequence. Because some wet-lab materials were not delivered in time, this project was validated mainly through DNA design, sequence annotation, open reading frame verification, expected protein translation, molecular weight estimation, and a future experimental protocol.

The proposed future workflow includes recombinant expression in a T7-based bacterial system, His-tag purification, centrifugal ultrafiltration as an alternative to SpeedVac concentration, wet-spinning into a coagulation bath, and testing of the resulting fiber. Musical instrument strings are treated as one possible downstream application because they require a material that can hold tension while vibrating predictably. However, the central goal of the project is broader: engineering recombinant spider silk as a tunable biomaterial platform.


SECTION 2: PROJECT AIMS

Aim 1: Experimental Aim

The first aim of this project is to design and validate a recombinant DNA construct encoding a spider-silk-inspired mini-spidroin protein. This includes verifying that the sequence contains the expected expression elements, translates in frame from the first start codon, avoids premature stop codons, and ends with a C-terminal 6xHis tag for purification. This aim was completed computationally using Benchling sequence annotation and translation of the 476 bp construct.

Aim 2: Developmental Aim

The second aim is to develop a realistic protocol for producing the designed protein and converting it into a fiber. The planned workflow includes expression in a T7-based E. coli system, cell lysis, nickel affinity purification of the His-tagged protein, concentration of the purified protein, and wet-spinning into a coagulation bath.

Since the lab did not have a Savant SpeedVac DNA 130 Integrated Vacuum Concentrator System, the protocol was modified to use centrifugal ultrafiltration as the preferred alternative method for concentrating the purified protein. This keeps the workflow realistic with available lab equipment while still supporting the same downstream goal: producing a concentrated silk protein solution suitable for fiber formation.

Aim 3: Visionary Aim

The long-term aim is to develop recombinant spider silk as a tunable biomaterial platform. If the fiber can be produced reliably, its mechanical properties could be tested for several applications, including biodegradable textiles, medical materials, lightweight structural fibers, and acoustic materials.

Musical instrument strings are one motivating application because they require a fiber that can hold tension, resist breaking, and vibrate consistently. In the future, different mini-spidroin sequences could be designed to tune strength, elasticity, density, and resonance for different uses.


SECTION 3: BACKGROUND

1. Peer-Reviewed Research Citations

Xu and Lewis (1990) studied the structure of spider dragline silk and showed that spider silk proteins have a highly repetitive architecture. This is relevant to my project because my mini-spidroin DNA construct also uses repeated sequence motifs rather than a random protein sequence. Their work supports the idea that spider silk mechanics are connected to the arrangement of amino acid repeats, especially regions that contribute strength and flexibility. This helped guide my design toward a repeat-rich mini-spidroin-like protein with alanine-rich and glycine-rich regions.

Tokareva et al. (2013) reviewed recombinant DNA production of spider silk proteins and described why producing spider silk in engineered biological systems is promising but technically difficult. Full-length natural spidroins are very large and repetitive, which can make them challenging to synthesize, clone, and express. This directly supports my decision to design a shorter mini-spidroin-like construct instead of attempting to reproduce an entire natural spider silk protein. Their paper also helped frame my project as a design and expression problem, not just a material testing problem.

2. Literature and Biological Context

Spider silk is known for combining high tensile strength, extensibility, and toughness. These properties arise from the organization of repetitive protein domains. Alanine-rich regions in spider silk proteins are associated with ordered beta-sheet crystalline domains, while glycine-rich regions behave more like flexible amorphous spacers. Together, these regions help spider silk combine strength with flexibility.

A full natural spider silk protein is extremely large and repetitive, which makes it difficult to synthesize, clone, and express in a short course project. I therefore designed a mini-spidroin-like construct. This shorter design is not expected to fully reproduce natural spider silk, but it captures the key sequence logic: repeated alanine-rich regions for ordered strength-forming domains and glycine-rich regions for flexibility. This makes it a realistic first engineering cycle.

These papers also support an important limitation of the project: making a silk-like protein sequence is not the same as proving that it forms a strong fiber. Recombinant silk properties depend on both the protein sequence and the processing conditions used after expression. Wet-spinning, coagulation bath composition, protein concentration, and post-spin drawing can all affect whether the final material becomes a continuous, handleable fiber. For this reason, my current result is best described as a design-validated mini-spidroin construct and proposed experimental workflow, rather than a completed demonstration of functional spider silk.

This structure is useful for engineering fibers. A useful fiber must be strong enough to resist breaking but flexible enough to deform under stress. This is especially important for applications such as textiles, biomedical fibers, and acoustic strings. For a musical string application, the frequency of vibration depends on length, tension, and linear density:

f = (1 / 2L) * sqrt(T / μ)

In this equation, f is frequency, L is string length, T is tension, and μ is linear mass density. A good acoustic fiber therefore needs a balance between strength, elasticity, and density. Spider-silk-inspired proteins are interesting because their mechanical behavior can potentially be tuned at the DNA sequence level.

3. Novelty and Innovation

This project is novel because it designs spider silk as an engineered biomaterial from the DNA level rather than treating silk as only a naturally harvested material. The project connects DNA design, protein engineering, purification, concentration, wet-spinning, and material testing in one workflow. The sequence was built to contain expression elements, repetitive silk-like coding regions, and a purification tag that supports a realistic production pipeline.

The design is also intentionally modest. Instead of trying to reproduce a complete natural spidroin, which would be difficult to synthesize and express, this project uses a smaller repeat-rich construct that captures the basic alanine-rich and glycine-rich pattern. This makes the project feasible while still connecting the DNA sequence to a material property hypothesis.

The musical instrument string application adds an additional layer of novelty because it gives the fiber a clear functional test. Instead of only asking whether a fiber can be made, the project asks whether the fiber could eventually be useful under tension and vibration. However, the application does not define the entire project. The main innovation is the design of a recombinant spider-silk-inspired fiber platform.

4. Project Significance and Impact

This project matters because spider silk-like materials could provide sustainable alternatives to petroleum-based polymers and other conventional fibers. A biologically produced fiber could be biodegradable, tunable, and produced under milder conditions than many synthetic materials. If recombinant silk fibers can be made strong and flexible, they could be useful in textiles, biomedical materials, packaging, lightweight structures, and other material applications.

The project also matters scientifically because it shows how synthetic biology can be used to design physical materials. Instead of only engineering cells to produce chemicals or signals, this project uses DNA to specify a protein that can become a macroscopic fiber. The acoustic string idea is one concrete application, but the broader contribution is a testable framework for linking DNA sequence to material behavior.

The expected impact at this stage is not a finished commercial material. The impact is a validated design and workflow that could be used in future work. If expression, purification, and spinning are successful later, the same workflow could be used to compare different mini-spidroin sequences and test how sequence changes affect fiber formation, strength, flexibility, and possible acoustic behavior.

5. Ethical Implications

The main ethical considerations are biosafety, environmental responsibility, and responsible use of engineered materials. The proposed host organism would be a non-pathogenic laboratory strain of E. coli, and all work should follow standard course biosafety protocols. Since the project involves recombinant DNA and protein production, cells and waste should be handled using approved containment and disposal procedures.

Environmental responsibility is also important. The project is motivated by sustainability, but the wet-spinning process may involve alcohols or other chemical baths. These should not be treated as harmless just because the final material is biological. Chemical waste should be collected and disposed of properly.

Another ethical issue is that high-strength biomaterials could have applications outside the intended context. For that reason, the project should be framed around transparent, peaceful, and sustainable material development. The current construct is also a small educational mini-spidroin-like design, not a finished high-performance material, which reduces immediate dual-use concern while still making responsible framing important.


SECTION 4: EXPERIMENTAL DESIGN, TECHNIQUES, TOOLS, AND TECHNOLOGY

1. Detailed Experimental Plan

The experimental plan is centered on producing a recombinant spider-silk-inspired fiber. The musical string idea is used as a possible downstream application and testing case, but the main technical objective is to design, express, purify, concentrate, and spin a mini-spidroin protein into a physical fiber.

Part 1: DNA Construct Design and Validation

The starting point of the project was the following 476 bp DNA sequence:

TAATACGACTCACTATAGGGAAAGAGGAGAAAATGAGCTATCAGCAAGGCCAGGGTGCGGGCGCAGCCGCGGCTGCAGCCGCGGCTGCAGCCGGTGGCGCGGGCCAGGGTGGCTATGGCGGCCTGGGCAGCCAGGGCGCGGGTGCTGCAGCCGCGGCTGCAGCCGCGGCTGCAGGCGGTGCGGGCCAGGGTGGCTACGGCGGTCTGGGCAGCCAGGGTGCGGGCGCCGCGGCTGCAGCCGCGGCTGCAGCCGCGGGCGGCGCGGGCCAGGGTGGCTATGGCGGCCTGGGCAGCCAGGGCGCGGGTGCTGCAGCCGCGGCTGCAGCCGCGGCTGCAGGCGGTGCGGGCCAGGGTGGCTACGGCGGTCTGGGCAGCCAGGGTGCGGGCGCCGCGGCTGCAGCCGCGGCTGCAGCCGCGGGCGGCGCGGGCCAGGGTGGCTATGGCGGCCTGGGCCATCATCATCATCATCATTAATAA
Benchling DNA construct map

Benchling annotation of the construct indicates the intended organization: a promoter region, an RBS upstream of the coding sequence, a long repetitive spider-silk-inspired gene region, a C-terminal 6xHis tag, and terminal stop codons. The promoter region includes the T7 promoter sequence:

TAATACGACTCACTATAGGG

This promoter was included so the construct could be used in a T7-based expression system. Downstream of this region, the sequence includes an RBS before the start codon. Translation begins at the first ATG.

The translated protein sequence is:

MSYQQGQGAGAAAAAAAAAAGGAGQGGYGGLGSQGAGAAAAAAAAAAGGAGQGGYGGLGSQGAGAAAAAAAAAAGGAGQGGYGGLGSQGAGAAAAAAAAAAGGAGQGGYGGLGSQGAGAAAAAAAAAAGGAGQGGYGGLGHHHHHH

This protein is 146 amino acids long and ends with a C-terminal 6xHis tag. The His tag was included so that the protein could be purified using nickel affinity chromatography. The final TAA TAA double stop codon was included to terminate translation.

The design works as a first-pass mini-spidroin design because it preserves some of the main structure-function logic of spider silk. The repeated alanine-rich sections are expected to encourage ordered domains that could contribute to strength and stiffness. The glycine-rich regions are expected to contribute flexibility. These features are useful for many fiber applications because a strong material still needs some ability to deform without immediately breaking. For a musical instrument string specifically, this balance is important because the material must tolerate tension while vibrating in a controlled way.

Although the construct contains a T7 promoter and RBS annotation, actual protein expression would still depend on the final plasmid context, host strain, spacing between the RBS and start codon, local RNA structure, and induction conditions. Therefore, the computational design validates the intended construct logic but does not guarantee high expression.

Part 2: Recombinant Expression Plan

The planned next step is to express the mini-spidroin protein in a T7-based E. coli expression system.

  1. Transform the plasmid containing the mini-spidroin construct into a suitable expression strain such as E. coli BL21(DE3).
  2. Plate transformed cells on the correct antibiotic selection plate.
  3. Pick a single colony and grow a starter culture.
  4. Use the starter culture to inoculate a larger expression culture.
  5. Grow cells to the appropriate induction window.
  6. Induce expression using the T7 system.
  7. Harvest the cells by centrifugation.
  8. Store the cell pellet or proceed directly to lysis.

Expected result: successful expression would produce a new protein band near the expected molecular weight of the designed mini-spidroin.

Part 3: Protein Lysis and Purification

The protein was designed with a C-terminal His tag, so the planned purification method is immobilized metal affinity chromatography.

  1. Resuspend the harvested cell pellet in lysis buffer.
  2. Lyse the cells using an approved lab method such as sonication or chemical lysis.
  3. Centrifuge the lysate to remove insoluble debris.
  4. Apply the clarified lysate to nickel affinity resin.
  5. Wash the resin to remove weakly bound proteins.
  6. Elute the His-tagged mini-spidroin using imidazole-containing buffer.
  7. Analyze samples using SDS-PAGE.

The SDS-PAGE gel should include:

  • Uninduced control
  • Induced lysate
  • Flow-through
  • Wash fraction
  • Elution fraction

Expected result: the elution fraction should be enriched for a band near the predicted size of the mini-spidroin. This would support successful expression and purification, but it would not by itself prove that the protein can form a strong fiber.

Part 4: Concentrating the Protein Without a SpeedVac

The original plan included a Savant SpeedVac DNA 130 Integrated Vacuum Concentrator System, but this instrument was not available in the lab. The preferred alternative is centrifugal ultrafiltration.

Preferred alternative protocol:

  1. Load the purified protein solution into a centrifugal concentrator.
  2. Use a molecular weight cutoff smaller than the target protein, such as 3 kDa or 10 kDa.
  3. Centrifuge according to the concentrator instructions.
  4. Check the sample volume periodically.
  5. Stop before the sample dries out.
  6. Recover the concentrated protein from the top chamber.
  7. If buffer exchange is needed, add fresh buffer and repeat the concentration step.

This method is preferable because it is gentle, does not require vacuum evaporation, and is commonly used for concentrating proteins. It also avoids heating the sample, which could increase aggregation risk.

Backup alternative: protein precipitation and resuspension could be used if centrifugal filters are unavailable, but this is less ideal because silk-like proteins may aggregate irreversibly.

Project image 1 Project image 2

Part 5: Wet-Spinning the Fiber

The purpose of wet-spinning is to convert the concentrated protein solution into a solid fiber.

  1. Prepare concentrated mini-spidroin solution as the spinning dope.
  2. Load the solution into a syringe or simple extrusion setup.
  3. Extrude the solution through a narrow needle or tubing into a coagulation bath.
  4. Allow solvent exchange to collapse the protein into a solid fiber.
  5. Collect the forming fiber carefully.
  6. Stretch the fiber after formation to encourage chain alignment.
  7. Dry the fiber under controlled conditions.
  8. Store the fiber for future testing.

The expected mechanism is that the coagulation bath removes water and promotes protein chain collapse, while drawing helps align the protein chains along the fiber axis. The alanine-rich regions are expected to form stronger ordered domains, while the glycine-rich regions preserve flexibility. However, this would need to be tested experimentally because the exact behavior depends on protein concentration, folding, solvent conditions, and spinning parameters.

Part 6: Material and Application Testing

If the fiber is successfully produced, it can be tested as a physical material first, and then optionally tested for acoustic behavior.

  1. Measure fiber diameter using a microscope or caliper.
  2. Check whether the fiber can be dried and handled without breaking.
  3. Mount the fiber under mild tension.
  4. Measure qualitative stretch, strength, and brittleness.
  5. If the fiber survives tension, pluck or vibrate the fiber.
  6. Record the sound using a microphone or contact pickup.
  7. Analyze the signal using FFT to identify dominant frequency and harmonic content.
  8. Compare the acoustic response to a nylon or commercial string control.

Expected result: a successful fiber would survive handling, hold mild tension, and show properties consistent with a usable biomaterial fiber. A successful acoustic application would also produce a measurable vibration or sound signal. These are future expectations, not results already obtained.

Decision Checkpoints

  1. If Benchling translation shows a premature stop codon, redesign the coding sequence.
  2. If the His tag is not in frame, redesign the 3’ end before ordering.
  3. If SDS-PAGE shows no induced band, test different induction temperatures or expression times.
  4. If the protein is insoluble, test lower-temperature induction or purify from the soluble fraction after lysis.
  5. If concentration causes aggregation, reduce concentration speed, change buffer, or stop at a lower protein concentration.
  6. If wet-spinning fails to form a continuous fiber, adjust protein concentration, needle size, coagulation bath composition, or draw speed.

Techniques Relevant to This Project

Checked techniques:

  • DNA Construct Design
  • Protein Design
  • Use of Benchling
  • Databases and sequence analysis tools
  • Bioproduction
  • Bacterial Culturing
  • Protein Purification
  • Quality Control / Analysis
  • Centrifugation, Lysis, DNA/Protein Purification
  • Wet-spinning and fiber formation
  • Material testing
  • Optional acoustic data analysis

Not checked / not used:

  • DNA Sequencing
  • Restriction Enzyme Digestion
  • Gel Electrophoresis
  • Gibson Assembly
  • PCR Reactions
  • CRISPR/Cas9
  • Designing Prime Editing gRNA
  • Lab Automation / Opentrons
  • Cell-Free Reactions
  • Freeze-Dried Cell-Free Systems

Two Techniques Expanded

Technique 1: DNA Construct Design

DNA construct design was the most important completed technique in this project. I used the desired material function as the starting point, then designed a DNA sequence that encoded relevant protein features. The sequence includes a T7 promoter, an RBS, a start codon, a repetitive silk-like coding region, a C-terminal His tag, and double stop codons.

This technique was useful because the final material properties depend on the protein sequence. The alanine-rich regions were included to support strength through ordered domains, while the glycine-rich regions were included for flexibility. By translating the DNA sequence and checking the open reading frame, I confirmed that the construct should produce the intended mini-spidroin-like protein.

Technique 2: Protein Purification

Protein purification is essential because wet-spinning requires a reasonably pure and concentrated protein solution. The construct includes a C-terminal 6xHis tag, which allows purification using nickel affinity chromatography. In this method, the His-tagged protein binds to nickel resin while many other bacterial proteins are washed away.

This technique is useful for the final project because the fiber should be made mainly from the designed protein, not from a random mixture of bacterial proteins. Purification also makes downstream concentration and spinning more controlled. If the protein is successfully expressed, SDS-PAGE can be used to check whether the elution fraction contains an enriched band near the expected size.


Relevant Companies

Relevant companies include:

  • Twist Bioscience, because the project depends on synthetic DNA ordering and gene construction.
  • Asimov / Kernel, because the project involves designing genetic parts and expression systems.
  • Bolt / Bolt.bio, because it has worked on bioengineered spider-silk-inspired materials.
  • Opentrons, because future versions of this workflow could automate liquid handling steps such as transformations, purification setup, or screening.
  • Thermo Fisher Scientific, because many reagents, purification tools, and lab instruments for this workflow could come from them.
  • Millipore Sigma, because protein purification, concentration, and molecular biology reagents are directly relevant to the planned workflow.
  • Waters Corporation, because future material or protein analysis could involve analytical chemistry tools for characterizing purified protein or process outputs.

SECTION 5: RESULTS AND QUANTITATIVE EXPECTATIONS

1. What Was Actually Validated

Because the final DNA construct and wet-lab materials were not available in time, this project did not reach the stage of protein expression, purification, or fiber spinning. The completed result is therefore not a physical spider silk fiber, but a validated design package for producing one in a future experiment.

The main validated output was the 476 bp mini-spidroin DNA construct. Using Benchling, I checked that the construct contains the expected functional parts: promoter, RBS, coding region, C-terminal 6xHis tag, and stop codons. I also translated the sequence from the first ATG and confirmed that it produces a continuous 146 amino acid protein with no premature stop codons before the His tag.

This matters because several common design failures would have made the construct unusable. A frameshift, early stop codon, missing His tag, or incorrect reading frame would prevent the planned protein from being produced or purified correctly. The design passed these basic checks, so it is reasonable to move forward to expression testing once the DNA is available.

2. Key Quantitative Values

FeatureValueWhy it matters
DNA construct length476 bpConfirms the expected construct size
Protein length146 amino acidsDefines the size of the mini-spidroin-like protein
Expected molecular weightapproximately 11.7 kDaPredicts where the protein should appear on SDS-PAGE
Purification tagC-terminal 6xHisEnables nickel affinity purification
Stop codonsTAA TAATerminates translation after the His tag
Expected SDS-PAGE bandnear 12 kDaMain protein-level validation target
Current validation stagedesign validationNo claim of completed expression or fiber formation

The expected molecular weight is approximately 11.7 kDa because the sequence is unusually rich in glycine and alanine, which are relatively small amino acids. This means the protein is lighter than a typical 146 amino acid protein. In a future SDS-PAGE gel, the most important expected result would be an induced band near 12 kDa that becomes enriched after His-tag purification.

3. Expected Experimental Results

If the full protocol were completed successfully, the first experimental checkpoint would be protein expression. After induction in a T7-based E. coli system, the induced sample should show a stronger band near 12 kDa than the uninduced sample. This would suggest that the mini-spidroin-like protein was produced after induction.

The second checkpoint would be solubility after cell lysis. If the protein is soluble, it should appear in the clarified supernatant after centrifugation. If it appears mostly in the pellet, that would suggest aggregation or inclusion body formation, and the expression conditions would need to be changed.

The third checkpoint would be purification. Because the protein contains a C-terminal 6xHis tag, it should bind to nickel resin and become enriched in the elution fraction. A successful purification result would show a clearer band near 12 kDa in the elution lane than in the flow-through or wash lanes.

The fourth checkpoint would be concentration. The purified protein would need to be concentrated into a spinning dope using centrifugal ultrafiltration. A successful concentration step would reduce sample volume while keeping the protein soluble and avoiding visible precipitation or clogging.

The final checkpoint would be fiber formation. A successful wet-spinning result would produce a continuous, handleable filament after extrusion into a coagulation bath. This would not automatically prove the fiber is strong, but it would show that the protein solution can transition from a liquid spinning dope into a solid material.

4. Expected SDS-PAGE Layout

A future SDS-PAGE gel should include these lanes:

LaneSampleExpected observation
1Protein ladderSize reference
2Uninduced cellsWeak or absent band near 12 kDa
3Induced cellsNew or stronger band near 12 kDa
4Soluble lysateShows whether protein remains soluble
5Insoluble pelletShows whether protein aggregated
6Nickel column flow-throughProtein should be reduced if binding worked
7Wash fractionRemoves weakly bound proteins
8Elution fractionEnriched band near 12 kDa if purification worked

This gel would be more informative than a single purified sample because it would show where the protein goes at each stage. It would help answer whether the problem is expression, solubility, purification, or yield.

5. Success Criteria

The future experiment would be considered successful at the protein-design level if the induced E. coli sample shows a band near 12 kDa and the nickel affinity elution fraction is enriched for that same band. This would support the claim that the designed mini-spidroin-like protein was expressed and purified.

The experiment would be considered successful at the material-formation level if the concentrated protein solution can be extruded into a coagulation bath and collected as a continuous fiber. The first fiber does not need to be high-performance to be useful. Even a weak but continuous fiber would validate the next stage of the workflow and create a starting point for optimization.

The experiment would be considered successful at the application-testing level only if the fiber can be dried, handled, mounted under mild tension, and tested mechanically or acoustically. Since this stage was not reached, the current report should not claim that the material functions as a musical string.

6. Likely Failure Modes and What They Would Mean

One possible failure mode is no visible band near 12 kDa after induction. This would suggest poor expression, incorrect induction conditions, or a problem with the expression plasmid or host strain.

Another possible failure mode is that the protein appears mainly in the insoluble pellet after lysis. This would suggest aggregation or inclusion body formation. In that case, future optimization could test lower induction temperature, shorter induction time, weaker induction, or different buffer conditions.

A third possible failure mode is that the protein expresses but does not purify well. This could happen if the His tag is inaccessible, if the protein degrades, or if binding conditions are not compatible. In that case, the purification buffer, imidazole concentration, or tag placement could be optimized.

A fourth possible failure mode is aggregation during concentration. This is important because wet-spinning requires a concentrated protein solution, but over-concentration can cause precipitation. Future work would need to test concentration limits and buffer conditions before spinning.

A fifth possible failure mode is failure to form a continuous fiber. This would not necessarily mean the DNA design failed. It could mean the spinning conditions need optimization, such as protein concentration, needle diameter, extrusion speed, coagulation bath composition, or draw ratio.

7. What This Result Means

The current result should be interpreted as a design-validated recombinant silk workflow, not a completed spider silk material. The project successfully defines what protein should be made, how it should be purified, what molecular weight should be expected, and what future experimental checkpoints should be used. This is a useful stage because it reduces uncertainty before the wet-lab work begins.

The next experimental milestone would be to obtain the DNA construct, express it in a T7-compatible E. coli strain, and run the SDS-PAGE validation workflow. If the expected 12 kDa band appears and can be purified, the project can move to protein concentration and wet-spinning. If not, the SDS-PAGE lane pattern would help identify which step needs redesign.

SECTION 6: ADDITIONAL INFORMATION

References:

  • Xu, M., and Lewis, R. V. (1990). Structure of a protein superfiber: spider dragline silk. Proceedings of the National Academy of Sciences, 87(18), 7120-7124. https://doi.org/10.1073/pnas.87.18.7120

  • Tokareva, O., Michalczechen-Lacerda, V. A., Rech, E. L., and Kaplan, D. L. (2013). Recombinant DNA production of spider silk proteins. Microbial Biotechnology, 6(6), 651-663. https://doi.org/10.1111/1751-7915.12081

  • Teulé, F., Cooper, A. R., Furin, W. A., Bittencourt, D., Rech, E. L., Brooks, A., and Lewis, R. V. (2009). A protocol for the production of recombinant spider silk-like proteins for artificial fiber spinning. Nature Protocols, 4, 341-355. https://doi.org/10.1038/nprot.2008.250

  • Rising, A., and Johansson, J. (2015). Toward spinning artificial spider silk. Nature Chemical Biology, 11, 309-315. https://doi.org/10.1038/nchembio.1789

  • Benchling. Sequence analysis and annotation tools. Used for DNA construct annotation, open reading frame verification, and translated protein sequence analysis. https://www.benchling.com/

  • HTGAA 2026 course materials and final project guidelines. Used for project structure, required sections, technique checklist, and documentation expectations.

Supply List and Budget

ItemPurposeEstimated Cost
Synthetic DNA constructEncodes mini-spidroin design$80
Expression plasmid or cloning serviceHolds gene in expression context$50 to $150
E. coli BL21(DE3) or similar strainProtein expression host$80
LB or TB mediaCell growth$30 to $60
Antibiotic selection reagentMaintains plasmid$20 to $50
IPTG or induction reagentInduces expression$40 to $80
Lysis buffer reagentsProtein extraction$30 to $60
Nickel affinity resin or columnHis-tag purification$100 to $150
SDS-PAGE gel and ladderProtein validation$50 to $100
Centrifugal protein concentratorsAlternative to SpeedVac$50 to $120
Syringes, needles, tubingWet-spinning setup$30 to $60
Isopropanol or coagulation bath chemicalsFiber formation$20 to $50

Estimated total: $500 to $1000, depending on what is already available in the lab.


Project image 1 Project image 2

Figure X. More Lab Images.

FINAL SUMMARY

Overall, this project reached the design-validation stage of recombinant spider silk engineering as the DNA shipping was extremely delayed and hasn’t arrived yet. The 476 bp construct was shown to contain the intended expression architecture and to encode a continuous 146 amino acid mini-spidroin-like protein with a C-terminal 6xHis tag and an expected molecular weight of approximately 11.7 kDa. Although delayed materials prevented full wet-lab execution, the project produced a coherent DNA design, a justified protein sequence, a purification strategy, an alternative concentration protocol without SpeedVac, and a complete future workflow for spinning and testing recombinant silk fibers.

The musical string application gives one concrete direction for future testing, but the broader contribution is a tunable biomaterial platform based on engineered spider silk.

cover image cover image