Week 2 HW: DNA Read, Write and Edit

Part 1: Benchling & In-silico Gel Art

  • Benchling: 48,502 bp Lambda phage DNA.
    Open Project
  • Enzymes: NdeI, PvuII, SacI only.
    Selected enzymes Selected enzymes

Part 3: Protein Design - Human Lysozyme (hLYZ) (no Part 2 because no lab attendance yet)

UniProt: P61626
Why: Lyses Gram+ bacteria (clearing zones on plates); ~130 aa antimicrobial for food/biofilms.

Codon-opt for E. coli (I used VectorBuilder:See here See here:
ATGAAAGCGCTGATTGTGCTGGGCCTGGTGCTGCTGAGCGTGACCGTGCAGGGCAAAGTGTTTGAACGCTGTGAACTGGCCCGTACCCTGAAACGTCTGGGCATGGATGGCTATCGCGGCATTAGCCTGGCGAACTGGATGTGCCTGGCGAAATGGGAAAGCGGATATAACACCCGCGCGACCAACTATAACGCAGGCGATCGTAGCACCGATTATGGCATTTTCCAGATTAACAGCCGTTATTGGTGCAATGATGGCAAAACCCCGGGCGCCGTGAACGCGTGCCATCTGAGCTGTAGCGCCCTGCTGCAGGATAACATTGCGGATGCCGTGGCCTGCGCGAAACGCGTGGTGCGCGATCCGCAGGGCATTCGCGCGTGGGTGGCGTGGCGCAACCGCTGCCAGAACCGCGATGTTCGCCAGTACGTGCAGGGCTGTGGCGTG

Why codon optimized?:

DNA’s genetic code is degenerate: 64 codons encode 20 amino acids, but cells prefer “optimal” codons with abundant tRNAs. Human lysozyme (P61626) uses eukaryotic codons (e.g., AGA/CGA/CGG/CGC for Arg), rare in bacteria → ribosomal pausing → low protein (~1-10% max yield).

Optimization process:

  • Scan AA seq → Replace rare codons (e.g., AGA Arg → CGT/CGC).
  • GC ~50% (E. coli sweet spot).
  • Avoid RE sites/repeats.

Why E. coli?

K12/BL21 canonical:

  • 20min doubles.
  • T7/plasmids stocked.
  • Lysis halos assay.
  • BSL1/$1L.

Protein Production Technologies

To produce lysozyme from my codon-opt DNA (plasmid: T7 promoter + RBS + hLYZ + term + AmpR), two main paths: cell-dependent (in vivo) and cell-free (TXTL)—both HTGAA staples.

1. Cell-Dependent (E. coli BL21(DE3))

Tech: Chemical transformation → IPTG induction → lysis/purification.

Steps:

  1. Transform plasmid into competent BL21(DE3) (T7 RNA pol strain).
  2. LB+Amp plate (37°C overnight) → single colonies.
  3. Liquid culture → mid-log (OD600~0.6) → add 1mM IPTG (T7 binds promoter).
  4. Express 4h (A280 monitor) → centrifuge → lysozyme buffer lysis → Ni-NTA purify (His-tag).

Why: Scalable (L-scale), cheap, natural folding/chaperones. Yield: 50-200 mg/L. Assay: Lysis halos on Micrococcus luteus agar. Limit: Inclusion bodies if misfold.

2. Cell-Free (TXTL / PURExpress)

Tech: NEB PURExpress or NEB TXTL kit (plasmid-fed).

Steps:

  1. Mix: DNA template (10-100 ng), lysate/lysate-free enzymes, NTPs/aa-tRNAs, energy (PEP), Mg/ATP.
  2. 29-37°C incubate 4-16h (plate reader monitor if fluorescent tag).
  3. Direct assay (no purification): Add bacteria → halo formation.

Why: Rapid prototyping (hours), no cloning/transformation, toxic proteins OK. Yield: 1-10 μM (~0.1-1 mg/mL). HTGAA fave for Week 2 demos. Limit: Costly, short-lived.

Transcription/Translation (Central Dogma): DNA → transcription (RNA pol binds promoter → mRNA w/ RBS/5’UTR; ~100 nt/s).
mRNA → translation (30S ribosome binds RBS → 70S → tRNAs decode codons → peptide chain ~20 aa/s → release factor → fold).

Lysozyme: ~130 aa → active in <1 min post-Tx. Cell-free skips replication/folding issues!

Part 4 - STILL EDITING

Part 5.1 DNA Read

(i) What DNA would I sequence & why?

Synthetic DNA data storage archive (e.g., Microsoft/ETH Zurich 1PB encoded in 13.3 zettabytes of oligo pools).
Why: DNA stores 1 exabyte/gram (10^18 density, 1000+ year stability at 4°C vs HDD 5yrs/90% capacity loss). Perfect for AI training data, climate models, genomic libraries—HTGAA synbio extension (store lysozyme designs, node protocols). Error-correcting codes (FEC) handle 1-5% synthesis/seq errors. Applications: Space (NASA), biobanks, “DNA cloud”.

(ii) Technology: Oxford Nanopore MinION + PromethION (3rd-generation)

Why MinION: Long reads (>10kb) assemble repetitive oligo pools; portable (USB, London node); real-time basecalling (Guppy 6.0, 98% raw→99.9% consensus). PromethION scales to 290Gb/run for PB archive.

Generation: 3rd—nanopore sequencing (single-molecule, no amplification bias, real-time vs SBS parallel/PCR).

Input/Preparation (100ng oligos):

  1. End-repair/A-tail: Blunt→A-overhangs (NEB Ultra II).
  2. Adapter ligation: SQK-LSK114 (motor protein + tether). No fragmentation (native length preserves codes).
  3. Loading: 30-48 flowcells, R9.4.1 pore.

Essential Steps & Base Calling:

  1. Threading: Helicase ratchets ssDNA through protein nanopore (α-hemolysin mutant).
  2. Ionic current: 4 bases uniquely modulate ~100pA current (A=high, C=mid, G=low, T=mid-low). Homopolymers ~3-10nt compress signal.
  3. Raw signal → Guppy neural net (RNN+Attention): Translates squiggles → FAST5 → FASTQ (Q10=99.9%). Dorado (GPU) live.
  4. Polish: Medaka/RACON consensus from 30x coverage.

Output: FASTQ reads (10-100kb), PHRED scores. Assemble → ECC decode → binary data.

Limits: Homopolymers (5% err), speed (450bases/s/pore), but duplex mode (both strands) → Q20.

Part 5.2 DNA Write

(i) What DNA to synthesize & why?

Codon-optimized human lysozyme (hLYZ, P61626) + Gibson homology arms for pET28a integration.
Why: Antimicrobial for food preservation (Gram+ lysis), biofilms, therapeutics. Twist-free (~$40), test lysis Week 4. Applications: Self-sterilizing surfaces, phage replacement.

(ii) Technology: Twist Bioscience (arrayed phosphoramidite synthesis → assembly)

Why: $0.09/bp, 1-5kb genes error-free, 10-14 day turnaround, HTGAA partner (Benchling→Twist integration).

Essential Steps:

  1. Oligo array synthesis: Inkjet print A/C/G/T phosphoramidites → 10^6 spots/plate → 200nt oligos (60mer tiles).
  2. Error correction: 4x coverage unique tiles → NGS validate → discard errors.
  3. Hierarchical assembly: Gibson (chemo-enzymatic overlap), NEBuilder HiFi.
  4. Cloning/Verification: Electrocompetent DH5α → colony PCR/Sanger → ship 2-5μg plasmid.

Limitations:

  • Speed: 2wks (vs enzymatic 2days).
  • Accuracy: 99.9% post-assembly (raw oligos 1:100 err).
  • Scalability: 5kb genes ($450), 100kb pathways $$$; toxic/repeats fail.

Part 5.3 DNA Edit

(i) What DNA to edit & why?

E. coli MG1655 genome—insert hLYZ cassette (constitutive pro, RBS, hLYZ, term) at neutral locus (betT/aga).
Why: Chromosomal antibiotics eliminate plasmid loss/stability issues. Industrial: Self-lysing probiotics for food safety. Conservation: Edit coral bacteria to fight bleaching pathogens.

Edit: 1.2kb insertion replacing pseudogene.

(ii) Technology: CRISPR-Cas12a recombineering (enAsCas12a)

Why: TTN PAM (AT-rich E.coli), dual crRNAs multiplex, 90% HR efficiency w/ RecET. Better than Cas9 (NG PAM-limited).

How it edits: Cas12a crRNA binds target → RuvC cleaves → RecET boosts HDR from ssDNA donor.

Preparation/Steps:

  1. Design (Benchling): 22nt spacer + TTN PAM, 500-800nt ssDNA donor (40nt homology arms).
  2. Inputs: enAsCas12a protein (20μM), crRNA/tracrRNA (1μM), ssDNA (1μM), BL21 RecET cells.
  3. Electroporation: 25μF, mix → recover 37°C → plate Amp + lysis assay.
  4. Screen: PCR + Sanger verify insertion.

Limitations:

  • Efficiency: 10-50% (donor design critical).
  • Precision: 0.1% off-target (Cas12a collateral nuclease quenched).
  • Size: <3kb insertions optimal.

My spacer: GTTGATCTGGAAGCTGACCGC (betT locus).