Week 2 HW.4: Twist DNA Synthesis Order
Prepare a Twist DNA Synthesis Order
This is a practice exercise, not necessarily your real Twist order!
4.1. Create a Twist account and a Benchling account click through for Twist signup
click through for Twist signup click through for Benchling signup
click through for Benchling signup
4.2. Build Your DNA Insert Sequence
For example, let’s make a sequence that will make E. coli glow fluorescent green under UV light by constitutively (always) expressing sfGFP (a green fluorescent protein):
In Benchling, select New DNA/RNA sequence
Give your insert sequence a name and select DNA with a Linear topology (this is a linear sequence that will be inserted into a circular backbone vector of our choosing).
Go through each piece of the given DNA sequences highlighted below (Promoter, RBS, Start Codon, Coding Sequence, His Tag, Stop Codon, Terminator) and paste the sequences into the Benchling file one after the other (replacing the coding sequence with your codon optimized DNA sequence of interest!). Each time you add a new piece of the sequence, make sure to annotate by right clicking over the sequence and creating an annotation that describes what each piece (e.g., Promoter, RBS, etc.) is (see image below).
Promoter (e.g. BBa_J23106): TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGC
RBS (e.g. BBa_B0034 with spacers for optimal expression): CATTAAAGAGGAGAAAGGTACC
Start Codon: ATG
Coding Sequence (your codon optimized DNA for a protein of interest, sfGFP for example): AGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAA
7x His Tag (Let’s add a 7×His tag at the C-terminus of the protein to enable protein purification from E. coli): CATCACCATCACCATCATCAC
Stop Codon: TAA
Terminator (e.g. BBa_B0015): CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA
Once you’ve completed this, click on Linear Map to preview the entire sequence. If you intend to have a TA review a sequence in the future, this is a good way to verify that all sections are annotated!
This is not required for this exercise, but to share your design with others, please ensure that link sharing is turned on! (Optional) Share your final sequence link with a TA for review!
This insert sequence you built is commonly referred to as an expression cassette in molecular biology (a sequence you can drop into any vector and it’ll perform its function). Go ahead and download the FASTA file for the sequence you made.
It’s helpful to visualize DNA designs using SBOL Canvas (Synthetic Biology Open Language) to convey your designs. Here’s an example of what you just annotated in Benchling:
4.3. On Twist, Select The “Genes” Option
4.4. Select “Clonal Genes” option
For this demonstration, we’ll choose Clonal Genes. You’ll select clonal genes or gene fragments depending on your final project.
Historically, HTGAA projects using clonal genes (circular DNA) have reached experimental results 1-2 weeks quicker because they can be transformed directly into E. coli without additional assembly.
Gene fragments (linear DNA) offer greater design flexibility but typically require an assembly or cloning step prior to transformation. An advantage is If designed with the appropriate exonuclease protection, gene fragments can be used directly in cell-free expression.
4.5. Import your sequence
You just took an amino acid sequence of interest and converted it into DNA, codon optimized it, and built an expression cassette around it! Choose the Nucleotide Sequence option and Upload Sequence File to upload your FASTA file.
4.6. Choose Your Vector
Since we’re ordering a clonal gene, you will need to refer to Twist’s Vector Catalog to choose your circular backbone. You can think of this as taking your linear expression cassette for your protein of interest, and completing the rest of the circle!
The backbone confers many special properties like antibiotic resistance, an origin of replication, and more. Discuss with your node to decide on appropriate antibiotic options. At MIT/Harvard, you can use Ampicillin, Chloramphenicol, or Kanamycin resistance.
Twist vectors do not contain restriction sites near the insert fragment, so make sure to flank your design with cut sites if you are intending to extract this DNA insert fragment later.
For this demonstration, choose a Twist cloning vectors like pTwist Amp High Copy.
Click into your sequence and select download construct (GenBank) to get the full plasmid sequence:
Go back to your Benchling account. Inside of a folder, click the import DNA/RNA sequence button and upload the GenBank file you just downloaded.
This is the plasmid you just built with your expression cassette included. Congratulations on building your first plasmid!