Week 6 HW: Genetic Circuits: Part I
Answer these questions about the protocol in this week’s lab:
1. What are some components in the Phusion High-Fidelity PCR Master Mix and what is their purpose?
Components of the Phusion High-Fidelity PCR Master Mix and their purpose:
- Phusion DNA polymerase – a high-fidelity DNA polymerase that synthesizes new DNA strands with a low error rate during PCR.
- Primers (forward and reverse) – short DNA sequences that bind to the target DNA and define the region that will be amplified.
- dNTPs (dATP, dTTP, dCTP, dGTP) – the nucleotide building blocks used by the polymerase to synthesize new DNA strands.
- Reaction buffer – maintains optimal pH and ionic conditions for proper enzyme activity.
- Mg²⁺ ions – an essential cofactor required for DNA polymerase catalytic activity.
- Nuclease-free water – maintains the correct reaction volume and prevents degradation of DNA.
2. What are some factors that determine primer annealing temperature during PCR?
- Primer melting temperature (Tm) – The annealing temperature is usually set about 3–5 °C below the primer Tm to allow specific binding to the DNA template.
- Primer length – Longer primers generally have higher Tm values, which increases the annealing temperature.
- GC content – Primers with higher GC content bind more strongly (three hydrogen bonds), increasing Tm and the annealing temperature.
- Primer–template complementarity – Mismatches between the primer and the template reduce binding efficiency and may require a lower annealing temperature.
- Reaction conditions – Salt concentration and Mg²⁺ levels in the PCR mix influence DNA stability and can affect the optimal annealing temperature.
3. There are two methods from this class that create linear fragments of DNA: PCR, and restriction enzyme digests. Compare and contrast these two methods, both in terms of protocol as well as when one may be preferable to use over the other.
Comparison of PCR and Restriction Enzyme Digestion
| Criterion | PCR (Polymerase Chain Reaction) | Restriction Enzyme Digestion |
|---|---|---|
| Underlying mechanism | DNA amplification using primers and a thermostable DNA polymerase through repeated thermal cycles. | Enzymatic cleavage of DNA at specific recognition sequences by restriction endonucleases. |
| Key reagents | DNA template, forward and reverse primers, DNA polymerase (e.g., Taq or Phusion), dNTPs, buffer. | Restriction enzyme(s), compatible reaction buffer, and DNA substrate. |
| Sequence constraints | Only requires primer binding regions; primers can be designed to introduce mutations or overlaps. | Requires pre-existing restriction sites within the DNA sequence. |
| Experimental flexibility | Highly adaptable; enables mutagenesis, sequence insertion, and creation of overlaps for cloning strategies such as Gibson Assembly. | Limited flexibility; modification depends on the presence and position of restriction sites. |
| Resulting DNA product | Defined amplified DNA fragment. | DNA fragments generated by site-specific cleavage. |
| Typical applications | Gene amplification, site-directed mutagenesis, preparation of fragments for advanced cloning methods. | Traditional cloning workflows where compatible restriction sites are available. |
| When it is preferred | When sequence modification or precise amplification is required. | When simple and reliable DNA cutting is sufficient for cloning. |
4. How can you ensure that the DNA sequences that you have digested and PCR-ed will be appropriate for Gibson cloning?
- Design 20–40 bp complementary overhangs between adjacent DNA fragments.
- Include the correct 5′ overhangs in PCR primers so fragments share matching overlaps.
- Ensure fragments are in the correct 5′→3′ orientation for proper assembly.
- Avoid secondary structures (e.g., hairpins or primer dimers) in the overlap regions.
5. How does the plasmid DNA enter the E. coli cells during transformation?
- Heat shock: A sudden temperature change creates temporary pores in the membrane, allowing plasmid DNA to enter.
- Electroporation: An electrical pulse creates pores in the membrane through which plasmid DNA enters the cell.
6. Describe another assembly method in detail (such as Golden Gate Assembly). Explain the other method in 5 - 7 sentences plus diagrams (either handmade or online).
Golden Gate Assembly is a molecular cloning method that allows the assembly of multiple DNA fragments in a single reaction. It uses Type IIS restriction enzymes (such as BsaI) together with DNA ligase. These enzymes cut DNA outside of their recognition site, creating specific overhangs that can be designed to match between fragments. The complementary overhangs allow the DNA fragments to anneal in a predefined order. DNA ligase then joins the fragments together to form a continuous DNA molecule. Because the restriction sites are removed during the process, the final assembled DNA can no longer be cut again, making the reaction efficient and directional. This method allows the simultaneous and seamless assembly of multiple fragments in one tube.
DNA Fragment A [ATGCGTACGTTAGCTAGCTAGCGATCGATCGTAGCTAGCTAGCTA]
DNA Fragment B [AGCTATTTGCGGATCGATCA]
DNA Fragment C [ATCAGGCTAGCGTATCGTAA]
Golden Gate Assembly – Conceptual Diagram
These overhangs ensure correct directional assembly of fragments A, B, and C. The sequences have been prepared and modified to include the complementary overhangs for accurate Golden Gate assembly simulation in Benchling.
Golden Gate Assembly Overhangs
Fragment A → Fragment B
| Fragment A (5’→3’) | Fragment B (5’→3’) | Overhang (A → B, antiparallel) |
|---|---|---|
| ATGCGTACGTTAGCTAGCTAGCGATCGATCGTAGCTAGCTAGCTA | AGCTATTTGCGGATCGATCA | TAGC → GCTA |
Fragment B → Fragment C
| Fragment B (5’→3’) | Fragment C (5’→3’) | Overhang (B → C, antiparallel) |
|---|---|---|
| AGCTATTTGCGGATCGATCA | ATCAGGCTAGCGTATCGTAA | CGAT → GCTA |
overhangs’ summary
| Fragment | Overhang 5’ | Overhang 3’ |
|---|---|---|
| A | — | AGCT |
| B | TCGA | ATCG |
| C | TAGC | — |
Screen shots from Benchling:
Final constructor.