ππͺπ»π²πͺπ· π₯πͺπ΅ππ²πΏπ²πͺ π§¬πβ HTGAA Spring 2026
About me
Hi! My name is Marian
I completed my undergraduate degree in Biotechnological Engineering from UCSM in Peru. I have a strong interest in bees, beekeeping, and meliponiculture π, fun fact I’m highly allergic to bee stings.
Also, I love molecular biology 𧬠and the early study and detection of neurological diseases π§ . My goal is to pursue postgraduate studies in Synthetic Biology abroad.
Part I: Benchling & In-silico Gel Art I created my benchling account and imported the sequence GEN BANK CODE:J02459.1 from the NCBI website. I added the sequence to my benchling proyect folder. Then I simulated Restriction Enzyme Digestion with adding the following enzymes and then cutted the DNA in the restricted places
I created my benchling account and imported the sequence GEN BANK CODE:J02459.1 from the NCBI website. I added the sequence to my benchling proyect folder.
Then I simulated Restriction Enzyme Digestion with adding the following enzymes and then cutted the DNA in the restricted places
I’ve chosen phospholipase A2 originating from Apis mellifera due to being a key enzymatic factor of honeybee venom and for their study as potential neuroprotective and immunomodulatory agents. Bee venom phospholipase A2 has been reported as having properties that reduce neuroinflammation and protect dopaminergic neurons in animal models of Parkinson’s Disease.
3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.
Using a reverse translation tool, I converted my amino acid sequence into a nucleotide sequence based on the standard genetic code. Because multiple codons can encode the same amino acid, the resulting sequence represents one of several possible valid sequences that could produce this protein.
I obtained the nucleotides using the following tool available on internet: https://www.bioinformatics.org/sms2/rev_trans.html
reverse translation of sample sequence to a 501 base sequence of most likely codons.
atgcaggtggtgctgggcagcctgtttctgctgctgctgagcaccagccatggctggcag
attcgcgatcgcattggcgataacgaactggaagaacgcattatttatccgggcaccctg
tggtgcggccatggcaacaaaagcagcggcccgaacgaactgggccgctttaaacatacc
gatgcgtgctgccgcacccatgatatgtgcccggatgtgatgagcgcgggcgaaagcaaa
catggcctgaccaacaccgcgagccatacccgcctgagctgcgattgcgatgataaattt
tatgattgcctgaaaaacagcgcggataccattagcagctattttgtgggcaaaatgtat
tttaacctgattgataccaaatgctataaactggaacatccggtgaccggctgcggcgaa
cgcaccgaaggccgctgcctgcattataccgtggataaaagcaaaccgaaagtgtatcag
tggtttgatctgcgcaaatat
3.3. Codon optimization.
I need to optimize my codons so that the chosen organism can express them accurately.
Chosen organism: E. coli
I optimized my sequence for expression in E. coli K12 usign the following tool: JCat
I realized that the Codon Adaptation Index improve from a value of 0.58 to 1.0, indicating optimal codon usage for the host organism.
The GC content of the optimized sequence (51.3%) is consistent with the genomic GC content of E. coli.
Translation of the optimized sequence confirmed that the amino acid sequence remained unchanged because it matches with the previous protein equence I obtained in part 3.1 from Uniprot.
3.4. You have a sequence! Now what?
Using an expression vector, the recombinant DNA sequence (which has an optimized codon) can be cloned into a host organism.
The host cell transcribes this new DNA sequence into mRNA, which is then translated into protein.
Protein production can be done using either cell-based or cell-free expression systems; however, toxic proteins should generally be produced using a cell-free expression system to avoid harming the host organism.
Part V: DNA Read/Write/Edit
5.1 DNA Read
(i) What DNA would you want to sequence (e.g., read) and why?
(ii) What technology or technologies would you use to perform sequencing on your DNA and why?