My visit at one of the 2 fungi farms in Cyprus in 2023
First weeks assignment Describe a biological engineering application or tool you want to develop and why. This could be inspired by an idea for your HTGAA class project and/or something for which you are already doing in your research, or something you are just curious about.
Geeking out over protein structures and data banks, DNA storage in plants, clouds and decoding DNA into sound I love that artist Antoine Bertin has decoded the RNA of SARS COV 2 into this track! check it out.
Antoine Bertin · Meditation on SARS-CoV-2 This is the RNA of the Coronavirus translated into sound (viruses are made of RNA, not exactly DNA). Each nucleotide of the RNA (A,U,G or C) is transformed into a note so the virus sequence can be heard. The tempo of the track follows the rhythm at which the epidemic is growing (exponential curve) and how this curve flattens if we all stay home :) I wanted to create a track that can help with relaxation in times of isolation, and meditate on the fact all life on earth, including viruses, are made of the same material. We (humans, animals, trees, bacteria, viruses) are the continuation of a same common ancestor. Anyway; I hope this will helps everyone explore in their own sonic way what we are going through! Here is an extract of the RNA sequence :)
[E-INK] MICROFLUIDICS <3 I have actually been interested in microfluidics in a while because I am into inflatables and soft robotics since 2020. I started working with bodily fluids and liquids in 2023. I love this little sweat collection and analysis wearable microfluidic system device.
You can find another example here and the paper.
My visit at one of the 2 fungi farms in Cyprus in 2023
First weeks assignment
Describe a biological engineering application or tool you want to develop and why. This could be inspired by an idea for your HTGAA class project and/or something for which you are already doing in your research, or something you are just curious about.
Next, describe one or more governance/policy goals related to ensuring that this application or tool contributes to an “ethical” future, like ensuring non-malfeasance (preventing harm). Break big goals down into two or more specific sub-goals. Below is one example framework (developed in the context of synthetic genomics) you can choose to use or adapt, or you can develop your own. The example was developed to consider policy goals of ensuring safety and security, alongside other goals, like promoting constructive uses, but you could propose other goals for example, those relating to equity or autonomy.
Describe at least three different potential governance “actions” by considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & “Success”). Try to outline a mix of actions (e.g. a new requirement/rule, incentive, or technical strategy) pursued by different “actors” (e.g. academic researchers, companies, federal regulators, law enforcement, etc). Draw upon your existing knowledge and a little additional digging, and feel free to use analogies to other domains (e.g. 3D printing, drones, financial systems, etc.).
Purpose: What is done now and what changes are you proposing?
Design: What is needed to make it “work”? (including the actor(s) involved - who must opt-in, fund, approve, or implement, etc)
Assumptions: What could you have wrong (incorrect assumptions, uncertainties)?
Risks of Failure & “Success”: How might this fail, including any unintended consequences of the “success” of your proposed actions?
Next, score (from 1-3 with, 1 as the best, or n/a) each of your governance actions against your rubric of policy goals. The following is one framework but feel free to make your own:
Does the option:
Option 1
Option 2
Option 3
Enhance Biosecurity
• By preventing incidents
• By helping respond
Foster Lab Safety
• By preventing incident
• By helping respond
Protect the environment
• By preventing incidents
• By helping respond
Other considerations
• Minimizing costs and burdens to stakeholders
• Feasibility?
• Not impede research
• Promote constructive applications
Last, drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why. Outline any trade-offs you considered as well as assumptions and uncertainties. For this, you can choose one or more relevant audiences for your recommendation, which could range from the very local (e.g. to MIT leadership or Cambridge Mayoral Office) to the national (e.g. to President Biden or the head of a Federal Agency) to the international (e.g. to the United Nations Office of the Secretary-General, or the leadership of a multinational firm or industry consortia). These could also be one of the “actor” groups in your matrix.
Reflecting on what you learned and did in class this week, outline any ethical concerns that arose, especially any that were new to you. Then propose any governance actions you think might be appropriate to address those issues. This should be included on your class page for this week.
An exploration into abandoned copper mines in Cyprus and the non existent restoration of toxic environments
I have been extremely interested in mycelium, plants and lichen. Lichen is a super queer and hybrid species that is a cross between fungi and algae. In recent years. Lichen are biosensors and bioindicators and some local plants are hyperaccumulators of heavy metals and they aid in bioremediation (through phytoremediation) and enviromental restoration of abandoned mines in Cyprus and other waste lands. Here you can find a conversation between the artist Helene Black and myself documenting my project We forgot how to forage as part of an artist residency. Helene Black is an artist, educator and cofounder of the interdisciplinary NGO, NeMe in Limassol, Cyprus. She has been researching abandoned copper mines and extractivism in Cyprus.
Here is a 3D scan of a cultivated petri dish. We tested the bodies of water of the river of abandoned Lefke mine.
As part of the Re(Grounding) program, myself and Ukrainian biohacker Dariia Dantseva of Yane lab completed a DIY biology workshop with a variety of groups of local citizens focusing on enviromental justice and restoration of abandoned copper mines through testing waters from Lefke mine river and Skouriotissa mine. We used readily available water test strips and then we proceeded with taking a water sample with a swab and trasfered it into the LB agar nutrient medium petri dishes. The participants used copper coins (british pennies and european cents) to test how resistant the existing micoorganisms in our water samples were to the copper inside the coin as as well as mixing samples from their microbiome (saliva, breath) with the contaminated water samples from the mines. The participants learned how to label their petri dishes, complete water pH tests with readily available test strips, and learned how to test fluids and swab them on petri dishes.
Lichen, plants and fungi for bioremediation, plastic degradation down plastics and monitoring enviromental changes and bioremediation
Alternatively, lichen and other endemic local plants are also being researched as biosensors or indicators of enviromental pollution and bioremediation of heavily pollutted environments. I live in Cyprus, where the british colonised us and started a bunch of copper mines that exported resources to nazi germany. After the 1974 war a lot of the mines were abandoned and some of them have been there since roman times. The mines have been abandoned and have never been rehabilitated and as a result the pollution still leaks through into our vegetables, fruit, drinking water and various bodies of water. I have completed a bunch of site specific visits to collect samples of water and to observe the flora and fauna of the abandoned mines. In the interview with Helene I talk about the local reseach around bioremediation of abandoned mines from Cypriot scientists.
1. A biological engineering application or tool you want to develop and why
MYCOREMEDIATION and SCAFFOLDS
Apart from my interest in bioremediation and phytoremediation, I am also extremely eager to explore a form of mycoremediation such as plastic or organic waste degrading mycelium for plastic pollution and waste management (mycoremediation). In the last 3 years I have been making a lot of biocomposite materials and working with crystallisation as well. The common root of crystallisation and mycelium cultivation is that both use scaffolds. Mycelium degrades organic or other material as a nutrient scaffold and as a helping hand in its cultivation journey and crystallisation can be combined with a scaffold that guides, support and induces the purification and formation of crystalline structure on pretty much made out of anything, organic or inorganic materials. Check my fabricademy page for more crystallisation scaffold techniques and tips.
I am quite curious as to which fungi can already break down and digest petroleum derived plastics and as to which fungi can be trained or modified. We have all heard about the fungi munching on radioactivity in Chernobyl and how mycelium is being utilised in bioremediation too! In addition, from my own research on abandoned mines and the flora and possible bioremediation of these sites I have discovered that some plants and organisms and microbes in soil and water have evolved to digest and breakdown different types of material waste and have evolved to accumulate heavy metals as well as bacteria in the polluted bodies of water have been evolved too.
In 1991, a species of fungi (Cladosporium sphaerospermum) was found growing inside the highly radioactive Chernobyl Exclusion Zone – an area deadly to most life. Fungi are already known for their extreme tolerance, often thriving in harsh environments, but this one does something scientifically compelling: it uses a process called radiosynthesis to absorb radiation (a form of energy, like sunlight) and uses it to fuel its cellular processes.found in petriandpen substack
“Fungi such as Pestalotiopsis microspora, Pleurotus ostreatus (oyster mushrooms), and Parengyodontium album, use enzymes to break down plastics, converting them into organic nutrients or harmless byproduct, Coastal pollution toolbox.org”.
In order to be able to understand how mycoremediation works we need to study how fungi degrade plastic and other organic or agricultural materials, their enzyme and metabolic actions and the mechanisms in which they grow, adhere and break down the plastic. In plastic degradation the mycelium adheres to the plastic using is also as a scaffold. Then we can study different types of plastics and if the plastics need pre-treatments for the fungi to be able to degrade the surface.
2. Describe one or more governance/policy goals related to ethical futures
What are our governance or policy goals and our audience and what is the application of this idea?
Break big goals down into two or more specific sub-goals.
Governance or policy goals for our idea
Household everyday DIY small scale level application- relating to equity, autonomy and empowerment of citizens to manage their own family waste in the comfort of their own homes or offices or businesses.
Reproductibility of homeowners or business owners- the process, tools and resources need to be accessible using simple diy tech and in different environments.
Protect the environment- Environmental Application- Researchers are exploring these fungi for use in landfills and specialized recycling, with studies showing significant degradation within weeks. While promising, scaling this technology for industrial use is a major focus for future research, with potential for implementation in 3–5 years. Helping respond to the management of tonnes of single plastic produced, not reused or upcycled and discarded every year.
Promoting constructive uses.
3. Potential governance “actions”
By considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & “Success”) we can discuss potential governance actions for our idea :)
Action 1
Create and instruct workshops and create citizen science groups around mycoremediation and empower citizens to learn to degrade their own plastic waste anywhere. Another branch for a variety of actors in other sectors is to again create specially designed workshops and training sessions for companies, offices and other corporate actors.
Purpose
Mycoremediation and alternative waste management processes are still quite unknown and are still being researched.
Design
NGOs and environmental non profits as well citizens initiatives.
Assumptions
That people are mentally ready to deal with their own plastic waste especially in an age where everything is bought ready made from food to clothes to anything.
Risks of failure
People do not want to take responsibility and it might overwhelm them since it is a newish field.
SUCCESS!!!
Increasing interest and autonomy from individual citizens to offices and businesses to manage their waste and become more sustainable and equitable.
Action 2
Enviromental and larger scale actions such as mycoremediating plastic waste landfills or other types of material waste on the stop in the affected sites.
Purpose
Locally nothing is being done as far as mycoremediation or regenerative waste management.
Design
Local governments, corporations, ngos, academic bodies for research and development.
Assumptions
That people will be willing to try it.
Risks of failure
Might be too costly and time consuming to get it right and need 3-5 years to scale up.
SUCCESS!!!
Citizens, home and officer owners degrade and manage their own waste, easily, diy etc.
Action 3
Create a citizen science group that tackles environmental purposes and goals and disseminate knowledge, resources, diy tools to become stewards of environmental justice and more autonomous.
Purpose
Not much is being done and locally there are not that many citizen science groups that are autonomous.
Design: What is needed to make it “work”? (including the actor(s) involved - who must opt-in, fund, approve, or implement, etc)
NGOS, non profits, research groups.
Assumptions: What could you have wrong (incorrect assumptions, uncertainties)?
Cannot really think right now!
Risks of Failure & “Success”: How might this fail, including any unintended consequences of the “success” of your
SUCCESS!!!
People become more autonomous.
4. Next, score (from 1-3 with, 1 as the best, or n/a) each of your governance actions against your rubric of policy goals. The following is one framework but feel free to make your own:
Does the option:
Option 1
Option 2
Option 3
Enhance Biosecurity
• By preventing incidents
• By helping respond
Foster Lab Safety
• By preventing incident
• By helping respond
Protect the environment
• By preventing incidents
*
• By helping respond
*
Other considerations
• Minimizing costs and burdens to stakeholders
*
• Feasibility?
• Not impede research
• Promote constructive applications
*
• Promote autonomy, equity
*
5. Drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why.
For example: Outline any trade-offs you considered as well as assumptions and uncertainties. For this, you can choose one or more relevant audiences for your recommendation, which could range from the very local (e.g. to MIT leadership or Cambridge Mayoral Office) to the national (e.g. to President Biden or the head of a Federal Agency) to the international (e.g. to the United Nations Office of the Secretary-General, or the leadership of a multinational firm or industry consortia). These could also be one of the “actor” groups in your matrix.
In our ideas case, I prioritize the household owners as main actors in my matrix; those who want to degrade and manage their personal plastic waste in the comfort of their own home and become more autonomous in managing their own waste without feeling like they are doing all the recycling and the waste management companies just burn them in a landfil. In the case of Cyprus this is what happens. People gather and recycle their waste but the companies are just burning them while charging people and the government.
Another idea is to create a mycoremediation start up that works similarly as a bio waste management company that goes around collecting the waste from users, businesses, offices etc and carry out the whole process in a “factory” but then the goal of equity, empowerment and autonomy in every household would not be valid, the goals will change once the main actors change.
New information
I took so many notes during the read, write and edit DNA lecture last night. Most of these concepts are new to me but I think I learned a bunch of new things that intrigued me and activated my curiosity. Below I will try to answer the homework questions with just going over the slides and doing some searching online if I must. Below you can find HW 2 PREP.
Homework Questions from Professor Jacobson
Q1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome. How does biology deal with that discrepancy?
A1. Polymerase has a high error rate and in biological synthesis of DNA, DNA polymerase is used and the Error Rate is 1:10 ^6 and throughput 10 mS per Base Addition [Beese et al. (1993), Science, 260, 352-355. .] The human genome consists of about 3 billion base pairs.
Biology has a way of dealing with discrepancies and errors through highly sophisticated processes of sensing, detecting, reporting, and repairing.
Q2. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest?
A2. There are multiple codons to express the same aminoacid which gives us abundant possibilities for coding for an average human protein. An average protein consists of 400-500 aminoacids and most aminoacids have similar codons among them so the possibilities of coding are extremely high with many combinations being created.
Homework questions from Dr. Natalie LeProust
Q1. What’s the most commonly used method for oligo synthesis currently?
A1. The method that is still being used since the 80’s- phosphoramidite DNA synthesis cycle. It is a 4 step cycle and it is based on light based deprotection.
Q2. Why is it difficult to make oligos longer than 200nt via direct synthesis?
A2. If you look at the yield of the oligo sythesis on the graph on the image above you will notice that it is decreasing over time according to the number of coupling. More coupling more time passes the yield decreases and more errors are starting to accumulate. The longer the length of the oligonucleotide the more errors and discrepancies it will carry. Cumulative inneficiency, yield loss over time and increased errors.
Q3. Why can’t you make a 2000bp gene via direct oligo synthesis?
There are length constains in direct oligo synthesis, especially for one continuous strand and through this method we cannot create 2000bp genes. With direct oligosynthesis you can make up to 150 bases. As I mentioned above long chains have low yield, increased errors and will be incredibly hard to purify. Longer sequences >200 bp require different methods such as the Gibson assembly 2009.
Homework questions from Dr. George Church
Choose ONE of the following three questions to answer; and please cite AI prompts or paper citations used, if any. I chose question number 1 and used multiple sources from the internet and Prof. Church’s slide #4.
Q1. Using Google & Prof. Church’s slide #4, What are the 10 essential amino acids in all animals and how does this affect your view of the “Lysine Contingency”?
A1. The 10 essential amino acids in all animals are:
In addition, the Lysine Contintency Jurassic-pedia, is a foolproof fall-back plan in Jurassic Park in order to ensure that the animals never left the island. It is about Henry Wu in Jurassic park had to come up with a contingency plan in case the dinosaus decided to escape the island and made a genetic alteration in the dinosaur genome and switched off their ability to produce the aminoacid Lysine. As a result they could not produce their own Lysine inside their bodies and had to depend on a constant external supply of Lysine by humans and therefore to become dependent on humans, veterinarians etc. It is quite inhumane in my opinion.
The 10 essential aminoacids as named above affect my view of the Lysine contingency and makes me think what would happen to all animals including humans that depend on these essential amino acids to survive as the essential aminoacids have to be consumed through food intake and cannot produced by our own bodies. What if someone played with our food and gatekept these essential to life aminoacids to create a contingency plan? How would we as humans react? Our food is already genetically modified and empty in nutrients in some cases. Makes me wonder…
Week 2 HW: DNA, READ, WRITE AND EDIT!
Geeking out over protein structures and data banks, DNA storage in plants, clouds and decoding DNA into sound
I love that artist Antoine Bertin has decoded the RNA of SARS COV 2 into this track! check it out.
This is the RNA of the Coronavirus translated into sound (viruses are made of RNA, not exactly DNA). Each nucleotide of the RNA (A,U,G or C) is transformed into a note so the virus sequence can be heard. The tempo of the track follows the rhythm at which the epidemic is growing (exponential curve) and how this curve flattens if we all stay home :) I wanted to create a track that can help with relaxation in times of isolation, and meditate on the fact all life on earth, including viruses, are made of the same material. We (humans, animals, trees, bacteria, viruses) are the continuation of a same common ancestor. Anyway; I hope this will helps everyone explore in their own sonic way what we are going through! Here is an extract of the RNA sequence :)
I had twisted sister in my mind while I was saying this, particularly I WANNA ROCK.
The 2nd week has been again packed with new information but I cannot wait to read, write and edit DNA as this it totally new information. In the past year I have had some health issues and have been to every single doctor and what is left is to get a DNA test to check for HLA Chromosome 6. The human leukocyte antigen (HLA) system is a complex of genes on chromosome 6 in humans that encode cell-surface proteins responsible for regulation of the immune system. Wish me luck!
Week 2- DNA Read, Write, & Edit HW
This week explores the read–write–edit toolkit: sequencing and synthesis workflows, restriction digests and gel electrophoresis, and early genome-editing frameworks.
Make sure to document every step of the in-silico and lab experiments. Make sketches, screenshots, notes, drawings… anything that helps you - and others - understand the experiment.
Part 0: Basics of Gel Electrophoresis
Gel electrophoresis separates DNA fragments based on size using:
Negatively charged DNA backbone
Electric field
Agarose matrix
Size-dependent migration
I attended and watched all lecture and recitation videos apart from the one last week on Thursday, the first meetup with Tokyo Bioclub node because I was setting up an exhibition and because with the time difference I did not see the email on time but I watched the recording :)
How does gel electrophoresis work?!
…and what does it look like?
I have known for a while how it looks like but I never really looked properly into it. I have been working with agar for a while now due to making biomaterials for textiles and edible materials too. In addition, I have also worked with other polymers too such as different kinds of alginate, gelatin and different kinds of starch.
Part 1: Benchling & In-silico Gel Art
See the Gel Art: Restriction Digests and Gel Electrophoresis protocol for details.
This is what the DNA sequence looks like in FASTA SEQUENCE FORMAT! I saved the file in a file document because it was the only available option on the the neb.com website. I did right click and saved in file format. Let’s see if we can import it like this in benchling!
Importing the lambda DNA sequence in benchling
First I created a new project on benchling named ‘htgaa week 2 - MARISA SATSIA’.
Then i imported the DNA!
Then I clicked on open sequence and VOILA!
Simulate Restriction Enzyme
You might wonder what a restriction enzyme is right?!
Simulate Restriction Enzyme Digestion with the following Enzymes:
EcoRI
HindIII
BamHI
KpnI
EcoRV
SacI
SalI
Here is the enzyme digest simulation with all the enzymes!
I made this using Ronan’s website. I think it is pretty cool to simulate this whole process and have a visual because I do not know when I am actually gonna do the lab!
Part 2: Gel Art - Restriction Digests and Gel Electrophoresis
Perform the lab experiment you designed in Part 1 and outlined in the Gel Art: Restriction Digests and Gel Electrophoresis protocol.
Unfortunately I cannot do that here in Cyprus, but I am actively looking for a lab to let me practice a bit.
Part 3: DNA Design
Part 3.1. Choose your protein
In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose.
[Example from our group homework, you may notice the particular format — The example below came from UniProt]
I choose the HPV genome proteins L1 (HPV16-L1) and L2(HPV16-L2). The HPV genome is surrounded by an icosahedral capsid consisting of two structural proteins: the major capsid protein L1 (HPV16-L1) and the minor capsid protein L2 (HPV16-L2). The L1 proteins are highly conserved and aggregate to form 72 fivefold capsomers. The L2 protein binds viral DNA. There are multiple types of HPV unfortunately and each affects us differently. Some types cause cervical cancer and some warts. There is an mRNA vaccine which I got when it first came out in 2007 or 2008 or 2009, when I was 18 or 19, I do not exactly remember.
L1 Protein Lengths by HPV Type
The L1 gene encodes the major capsid protein of the Human Papillomavirus (HPV), which spontaneously self-assembles into virus-like particles (VLPs)).
Because HPV has over 100 different genotypes, the exact sequence length varies slightly:
Below is the FASTA sequence for the L1 Major Capsid Protein of HPV Type 16, the strain responsible for approximately 50% of all cervical cancer cases worldwide. HPV 16 L1 Protein Sequence (UniProt P03101). This protein is 505 amino acids long and is the primary antigen used in HPV vaccines like Gardasil.
L1 SEQUENCE
sp|P03101|VL1_HPV16 Major capsid protein L1 OS=Human papillomavirus type 16 OX=333760 GN=L1 PE=1 SV=1
I also got this Pentamer Structure of Major Capsid protein L1 of Human Papilloma Virus type 11 from the 3d viewer from the RCSB PDB I love the 3d visualisation tool and the fact that you can isolate things and make animations and download 3d models.
Part 3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence
The Central Dogma discussed in class and recitation describes the process in which DNA sequence becomes transcribed and translated into protein. The Central Dogma gives us the framework to work backwards from a given protein sequence and infer the DNA sequence that the protein is derived from. Using one of the tools discussed in class, NCBI or online tools (google “reverse translation tools”), determine the nucleotide sequence that corresponds to the protein sequence you chose above.
This is the FASTA sequence of phage MS2 DNA genome on the website:
For the HPV 16 L1 Protein Sequence (UniProt P03101) the reverse translation or reverse engineering sequence iiiiisssss:
NC_001526.4:5560-7077 Human papillomavirus type 16 (HPV16), L1 major capsid protein
ATGAGCCTGTGGCTGCCCAGCGAGGCCACCGTGTACCTGCCTCCCGTGCCCGTGTCCAAG
GTGGTGAGCACCGACGAGTACGTGGCCCGGACCAACATCTACTACCACGCCGGCACCAGC
CGCCTGCTGGCCGTGGGCCACCCCTACTTCCCCATCAAGAAGCCCAACAACAACAAGATC
CTGGTGCCCAAGGTGAGCGGCCTGCAGTACCGGGTGTTCCGGATCCACCTGCCCGACCCC
AACAAGTTCGGCTTCCCCGACACCAGCTTCTACAACCCCGACACCCAGCGGCTGGTGTGG
GCCTGCGTGGGCGTGGAGGTGGGCCGGGGCCAGCCCCTGGGCGTGGGCATCAGCGGCCAC
CCCCTGCTGAACAAGCTGGACGACACCGAGAACGCCAGCGCCTACGCCGCCAACGCCGGC
GTGGACAACCGGGAGTGCATCAGCATGGACTACAAGCAGACCCAGCTGTGCCTGATCGGC
TGCAAGCCCCCCATCGGCGAGCACTGGGGCAAGGGCAGCCCCTGCACCAACGTGGCCGTG
AACCCCGGCGACTGCCCCCCACTGGAGCTGATCAACACCGTGATCCAGGACGGCGACATG
GTGCACACCGGCTTCGGCGCCATGGACTTCACCACCCTGCAGGCCAACAAGAGCGAGGTG
CCCCTGGACATCTGCACCAGCATCTGCAAGTACCCCGACTACATCAAGATGGTGAGCGAG
CCCTACGGCGACAGCCTGTTCTTCTACCTGCGGCGGGAGCAGATGTTCGTGCGGCACCTG
TTCAACCGGGCCGGCGCCGTGGGCGAGAACGTGCCCGACGACCTGTACATCAAGGGCAGC
GGCAGCACCGCCACCCTGGCCAACAACTACTACCCCACCCCCAGCGGCAGCATGGTGACC
AGCGACGCCCAGATCTTCAACAAGCCCTACTGGCTGCAGCGGGCCCAGGGCCACAACAAC
GGCATCTGCTGGGGCAACCAGCTGTTCGTGACCGTGGTGGACACCACCCGGAGCACCAAC
ATGAGCCTGTGCGCCGCCATCAGCACCAGCGAGACCACCTACAAGAACACCAACTTCAAG
GAGTACCTGCGGCACGGCGAGGAGTACGACCTGCAGTTCATCTTCCAGCTGTGCAAGATC
ACCCTGACCGCCGACGTGATGACCTACATCCACAGCATGAACAGCACCATCCTGGAGGAC
TGGAACTTCGGCCTGCAGCCCCCCCCCGGCGGCACCCTGGAGGACACCTACCGGTTCGTG
ACCAGCCAGGCCATCGCCTGCCAGAAGCACACCCCCCCCGCCCCCAAGGAGGACGACCCC
CTGAAGAAGTACACCTTCTGGGAGGTGAACCTGAAGGAGAAGTTCAGCGCCGACCTGGAC
CAGTTCCCCCTGGGCCGGAAGTTCCTGCTGCAGGCCGGCCTGAAGGCCAAGCCCAAGTTC
ACCCTGGGCAAGCGGAAGGCCACCCCCACCACCAGCAGCACCAGCACCACCGCCAAGCGG
AAGAAGCGGAAGCTGTAA
Official Reference Information
Database: NCBI GenBank / RefSeq
Accession Number: NC_001526.4
Locus Tag: HPV16gp6 (L1)
Coordinates: 5560 to 7077 (1518 base pairs)
Function: Major capsid protein; self-assembles into virus-like particles (VLPs) used in vaccines.
Part 3.3. Codon optimization
Once a nucleotide sequence of your protein is determined, you need to codon optimize your sequence. You may, once again, utilize google for a “codon optimization tool”. In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?
For the HPV 16 L1 protein DNA sequence with codon-optimization
According to AI the preferred codon optimization tool for HPV16 and HPV18, particularly for designing vaccines, is the Java Codon Adaptation Tool (JCat). JCat is used to adapt the codon usage of the HPV genes to the host organism (e.g., E. coli or humans) to improve protein expression.
In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?
For humans and for vaccine development.
Part 3.4. You have a sequence! Now what?
What technologies could be used to produce this protein from your DNA? Describe in your words the DNA sequence can be transcribed and translated into your protein. You may describe either cell-dependent or cell-free methods, or both.
I could use the twist dna synthesis.
Part 3.5. How does it work in nature/biological systems?
Describe how a single gene codes for multiple proteins at the transcriptional level.
Try aligning the DNA sequence, the transcribed RNA, and also the resulting translated Protein!!! See example below.
[Example shows the biomolecular flow in central dogma from DNA to RNA to Protein] Special note that all “T” were transcribed into “U” and that the 3-nt codon represents.
Part 4: Prepare a Twist DNA Synthesis Order
I do need someone to check my hw and tell me if i did everything right and I will finish this part asap!
Part 5: Read, write, edit!🔮
5.1 DNA Read
(i) What DNA would you want to sequence (e.g., read) and why? This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank)?
I would like to read HPV16 AND HPV18. It is important to me because of personal reasons.
(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why?
Several advanced technologies are used to analyze HPV DNA and RNA sequences, ranging from established clinical screening methods to cutting-edge research tools for detecting viral integration. The primary techniques include Next-Generation Sequencing (NGS), PCR-based methods, and molecular hybridization
.
Here is a breakdown of the technologies used for HPV DNA/RNA sequence analysis:
Next-Generation Sequencing (NGS)
NGS is used for high-throughput, comprehensive genomic analysis, including identifying multiple HPV subtypes, mutations, and integration sites.
Nanopore Sequencing (Third-Generation): This technology is used for long-read sequencing, allowing for the characterization of complete HPV genomes and the identification of HPV integration into the host genome. It is particularly useful for identifying chimeric cellular–viral reads.
Illumina Sequencing: Often combined with hybrid capture for high-accuracy sequencing of full HPV genomes.
HPV-KITE: A specialized algorithm that uses k-mer data analysis for rapid HPV detection from NGS data.
Nucleic Acid Amplification & Detection (DNA/RNA)
Real-Time PCR (qPCR): The most common method, using primers (e.g., L1, E6/E7) to amplify and quantify HPV DNA. Examples include Cobas HPV and BD Onclarity.
RT-PCR (Reverse Transcription PCR): Used specifically for detecting mRNA expression of E6 and E7 oncoproteins.
Transcription-Mediated Amplification (TMA): Used in the Aptima HPV Assay to detect E6/E7 mRNA for high-risk HPV.
Isothermal Amplification (IATs): Methods like Loop-Mediated Isothermal Amplification (LAMP) and Nucleic Acid Sequence-Based Amplification (NASBA) are used for rapid, isothermal detection without a thermocycler.
Droplet Digital PCR (ddPCR): Used for absolute quantification of HPV DNA/RNA with high sensitivity.
Signal Amplification & Hybridization
Hybrid Capture (HC2): A signal amplification method that uses RNA probes to hybridize with HPV DNA, which is then captured and detected via chemiluminescence.
Invader Technology: A signal amplification method (used in Cervista tests) that uses special enzymes to cleave DNA, creating a fluorescent signal.
DNA Microarray/Chips: Technologies like Linear Array or PapilloCheck detect multiple HPV types by hybridizing amplified DNA to specific probes.
Summary of Technologies by Goal
Goal Technology
Full Genome/Integration Nanopore Sequencing, Illumina
High-Risk DNA Screening Real-Time PCR (Cobas, Abbott), Hybrid Capture 2 (HC2)
Active Infection (RNA) RT-PCR (Aptima, NASBA)
Point-of-Care/Rapid LAMP, RPA, CRISPR-Cas12a
Also answer the following questions:
Is your method first-, second- or third-generation or other? How so?
What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps.
What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)?
What is the output of your chosen sequencing technology?
Apart from the cool robots for liquid handling in the lab I also really enjoyed the presentation on toehold switches/biosensors. I read some papers about the detection of HPV. I read some papers, have a look below!
Another paper was about High-sensitivity electrochemical detection of HPV DNA via enzyme-amplified target-induced hairpin opening on a thermally controlled paper-based digital microfluidic platform. You can find it here. I have been interested in bioelectronics for a while. Furthermore, the developed platform was successfully evaluated for HPV16 DNA detection from clinical cervical swab samples without requiring direct target amplification.
An electrochemical sensor integrated with a thermally controllable paper-based DMF (e-pDMF) device for target-induced hairpin opening with an enzyme-assisted signal amplification strategy (Scheme 1). This sensing platform is applied to detect HPV type 16 DNA (HPV16 DNA), a high-risk strain known to be a significant cause of cervical cancer. The e-pDMF device is designed to operate both transport and thermal features for precise droplet delivery and temperature control. The delivery mode enables efficient droplet manipulation and mixing, while the thermal zone on the device generates precise temperatures for optimal enzyme activity. Combining these functionalities allows for seamless operation, covering all steps from sample loading and mixing to signal amplification and electrochemical measurement. The HPV16 DNA opens the stem-loop structure of hairpin DNA (HP DNA) to form a duplex. Then, Exo III catalyzes the degradation of the duplex, releasing cleaved DNA and target DNA parts. The released target DNA part continues in cyclic enzymatic amplification, producing a large amount of cleaved DNA. This cleaved DNA is captured by a probe immobilized on the electrode surface. The decrease in current caused by electron transfer at the interface is measured using differential pulse voltammetry (DPV).
Week 03 HW
Assignment: Python Script for Opentrons Artwork — DUE BY YOUR LAB TIME!
Your task this week is to Create a Python file to run on an Opentrons liquid handling robot. Review this week’s recitation and this week’s lab for details on the Opentrons and programming it.
Generate an artistic design using the GUI at opentrons-art.rcdonovan.com.
Using the coordinates from the GUI, follow the instructions in the HTGAA26 Opentrons Colab to write your own Python script which draws your design using the Opentrons.
You may use AI assistance for this coding — Google Gemini is integrated into Colab (see the stylized star bottom center); it will do a good job writing functional Python, while you probably need to take charge of the art concept.
If you’re a proficient programmer and you’d rather code something mathematical or algorithmic instead of using your GUI coordinates, you may do that instead. If you use AI to help complete this homework or lab, document how you used AI and which models made contributions.
I also downloaded the 96 well plate python code from the website and here is a screenshot.
If you want copy and paste my code!
>from opentrons import types
import string
metadata = {
'protocolName': '{YOUR NAME} - Opentrons Art - HTGAA',
'author': 'HTGAA',
'source': 'HTGAA 2026',
'apiLevel': '2.20'
}
Z_VALUE_AGAR = 2.0
POINT_SIZE = 0.5
mclover3_points = [(27,23), (25,21), (29,21), (-29,19), (-25,19), (23,19), (-27,17), (-19,17), (19,17), (23,17), (-27,15), (-23,15), (-17,15), (-15,15), (15,15), (19,15), (21,15), (23,15), (-27,13), (-23,13), (-21,13), (-19,13), (15,13), (17,13), (19,13), (21,13), (23,13), (25,13), (-23,11), (-21,11), (-19,11), (-17,11), (-15,11), (-13,11), (-9,11), (11,11), (13,11), (15,11), (17,11), (19,11), (21,11), (23,11), (-27,9), (-23,9), (-21,9), (-19,9), (-17,9), (-15,9), (-13,9), (-11,9), (11,9), (13,9), (15,9), (17,9), (19,9), (21,9), (23,9), (-27,7), (-23,7), (-21,7), (-19,7), (-17,7), (-15,7), (-13,7), (-5,7), (-3,7), (-1,7), (1,7), (3,7), (5,7), (13,7), (15,7), (17,7), (19,7), (21,7), (23,7), (-25,5), (-23,5), (-21,5), (-19,5), (-17,5), (-9,5), (-7,5), (-5,5), (-3,5), (-1,5), (1,5), (3,5), (5,5), (7,5), (9,5), (17,5), (19,5), (21,5), (-25,3), (-23,3), (-21,3), (-19,3), (-13,3), (-11,3), (-9,3), (-7,3), (-5,3), (-3,3), (-1,3), (1,3), (3,3), (5,3), (7,3), (9,3), (11,3), (13,3), (19,3), (21,3), (23,3), (-21,1), (-15,1), (-13,1), (-11,1), (-9,1), (-7,1), (-5,1), (5,1), (7,1), (9,1), (11,1), (13,1), (15,1), (21,1), (-21,-1), (-17,-1), (-15,-1), (-13,-1), (-11,-1), (-9,-1), (-7,-1), (7,-1), (9,-1), (11,-1), (13,-1), (15,-1), (17,-1), (-17,-3), (-15,-3), (-13,-3), (-11,-3), (-9,-3), (-7,-3), (7,-3), (9,-3), (11,-3), (13,-3), (15,-3), (17,-3), (-19,-5), (-17,-5), (-15,-5), (-13,-5), (-11,-5), (-9,-5), (-7,-5), (7,-5), (9,-5), (11,-5), (13,-5), (15,-5), (17,-5), (19,-5), (-19,-7), (-17,-7), (-15,-7), (-13,-7), (-11,-7), (-7,-7), (-5,-7), (5,-7), (7,-7), (11,-7), (13,-7), (15,-7), (17,-7), (19,-7), (-21,-9), (-19,-9), (-17,-9), (-15,-9), (-13,-9), (1,-9), (11,-9), (15,-9), (17,-9), (19,-9), (-21,-11), (-19,-11), (-17,-11), (13,-11), (17,-11), (19,-11), (-19,-13), (-17,-13), (-15,-13), (-9,-13), (9,-13), (15,-13), (17,-13), (19,-13), (-29,-15), (-19,-15), (-17,-15), (11,-15), (19,-15), (-15,-17), (11,-17), (-17,-19), (9,-19), (17,-19), (-11,-21), (-1,-21), (1,-21), (11,-21), (-17,-23), (-13,-23), (13,-23), (17,-23), (19,-23)]
mrfp1_points = [(-29,21), (-27,21), (27,21), (-27,19), (25,19), (27,19), (-25,17), (-23,17), (21,17), (25,17), (27,17), (-25,15), (-21,15), (-19,15), (17,15), (25,15), (27,15), (-25,13), (-17,13), (-15,13), (-13,13), (11,13), (13,13), (-27,11), (-25,11), (-11,11), (9,11), (-25,9), (-5,9), (-3,9), (-1,9), (1,9), (3,9), (5,9), (9,9), (25,9), (-25,7), (-11,7), (-9,7), (-7,7), (7,7), (9,7), (11,7), (25,7), (-15,5), (-13,5), (-11,5), (11,5), (13,5), (15,5), (23,5), (25,5), (-17,3), (-15,3), (15,3), (17,3), (25,3), (-25,1), (-23,1), (-19,1), (-17,1), (17,1), (19,1), (23,1), (25,1), (-25,-1), (-23,-1), (-19,-1), (19,-1), (21,-1), (-21,-3), (-19,-3), (19,-3), (21,-3), (-21,-5), (21,-5), (-21,-7), (-9,-7), (9,-7), (21,-7), (-11,-9), (-5,-9), (-3,-9), (-1,-9), (3,-9), (5,-9), (13,-9), (21,-9), (-15,-11), (-13,-11), (15,-11), (21,-11), (-21,-13), (-11,-13), (11,-13), (21,-13), (-21,-15), (-15,-15), (-11,-15), (-9,-15), (9,-15), (15,-15), (17,-15), (21,-15), (27,-15), (-21,-17), (-19,-17), (-17,-17), (-11,-17), (-9,-17), (9,-17), (15,-17), (17,-17), (19,-17), (-19,-19), (1,-19), (19,-19), (-19,-21), (19,-21)]
mscarlet_i_points = [(-3,1), (-1,1), (1,1), (3,1), (-5,-1), (5,-1), (-5,-3), (-3,-3), (3,-3), (5,-3), (-5,-5), (-3,-5), (3,-5), (5,-5), (-3,-7), (1,-7), (3,-7)]
azurite_points = [(29,23), (-31,21), (-23,19), (21,19), (29,19), (-21,17), (17,17), (13,15), (-11,13), (9,13), (27,13), (25,11), (-9,9), (23,-1), (25,-1), (-23,-3), (-9,-9), (1,-11), (13,-13), (-25,-15), (-23,-15), (-7,-15), (7,-15), (23,-15), (29,-15), (-31,-17), (-29,-17), (-27,-17), (-25,-17), (-23,-17), (-13,-17), (7,-17), (13,-17), (21,-17), (23,-17), (25,-17), (27,-17), (29,-17), (31,-17), (-29,-19), (-27,-19), (-25,-19), (-23,-19), (-21,-19), (-15,-19), (-13,-19), (-9,-19), (11,-19), (13,-19), (15,-19), (21,-19), (23,-19), (25,-19), (27,-19), (29,-19), (-25,-21), (-21,-21), (-9,-21), (9,-21), (13,-21), (21,-21), (25,-21), (-19,-23), (15,-23)]
mwasabi_points = [(-27,-15), (25,-15)]
point_name_pairing = [("mclover3", mclover3_points),("mrfp1", mrfp1_points),("mscarlet_i", mscarlet_i_points),("azurite", azurite_points),("mwasabi", mwasabi_points)]
# Robot deck setup constants
TIP_RACK_DECK_SLOT = 9
COLORS_DECK_SLOT = 6
AGAR_DECK_SLOT = 5
PIPETTE_STARTING_TIP_WELL = 'A1'
# Place the PCR tubes in this order
well_colors = {
'A1': 'sfGFP',
'A2': 'mRFP1',
'A3': 'mKO2',
'A4': 'Venus',
'A5': 'mKate2_TF',
'A6': 'Azurite',
'A7': 'mCerulean3',
'A8': 'mClover3',
'A9': 'mJuniper',
'A10': 'mTurquoise2',
'A11': 'mBanana',
'A12': 'mPlum',
'B1': 'Electra2',
'B2': 'mWasabi',
'B3': 'mScarlet_I',
'B4': 'mPapaya',
'B5': 'eqFP578',
'B6': 'tdTomato',
'B7': 'DsRed',
'B8': 'mKate2',
'B9': 'EGFP',
'B10': 'mRuby2',
'B11': 'TagBFP',
'B12': 'mChartreuse_TF',
'C1': 'mLychee_TF',
'C2': 'mTagBFP2',
'C3': 'mEGFP',
'C4': 'mNeonGreen',
'C5': 'mAzamiGreen',
'C6': 'mWatermelon',
'C7': 'avGFP',
'C8': 'mCitrine',
'C9': 'mVenus',
'C10': 'mCherry',
'C11': 'mHoneydew',
'C12': 'TagRFP',
'D1': 'mTFP1',
'D2': 'Ultramarine',
'D3': 'ZsGreen1',
'D4': 'mMiCy',
'D5': 'mStayGold2',
'D6': 'PA_GFP'
}
volume_used = {
'mclover3': 0,
'mrfp1': 0,
'mscarlet_i': 0,
'azurite': 0,
'mwasabi': 0
}
def update_volume_remaining(current_color, quantity_to_aspirate):
rows = string.ascii_uppercase
for well, color in list(well_colors.items()):
if color == current_color:
if (volume_used[current_color] + quantity_to_aspirate) > 250:
# Move to next well horizontally by advancing row letter, keeping column number
row = well[0]
col = well[1:]
# Find next row letter
next_row = rows[rows.index(row) + 1]
next_well = f"{next_row}{col}"
del well_colors[well]
well_colors[next_well] = current_color
volume_used[current_color] = quantity_to_aspirate
else:
volume_used[current_color] += quantity_to_aspirate
break
def run(protocol):
# Load labware, modules and pipettes
protocol.home()
# Tips
tips_20ul = protocol.load_labware('opentrons_96_tiprack_20ul', TIP_RACK_DECK_SLOT, 'Opentrons 20uL Tips')
# Pipettes
pipette_20ul = protocol.load_instrument("p20_single_gen2", "right", [tips_20ul])
# Deep Well Plate
temperature_plate = protocol.load_labware('nest_96_wellplate_2ml_deep', 6)
# Agar Plate
agar_plate = protocol.load_labware('htgaa_agar_plate', AGAR_DECK_SLOT, 'Agar Plate')
agar_plate.set_offset(x=0.00, y=0.00, z=Z_VALUE_AGAR)
# Get the top-center of the plate, make sure the plate was calibrated before running this
center_location = agar_plate['A1'].top()
pipette_20ul.starting_tip = tips_20ul.well(PIPETTE_STARTING_TIP_WELL)
# Helper function (dispensing)
def dispense_and_jog(pipette, volume, location):
assert(isinstance(volume, (int, float)))
# Go above the location
above_location = location.move(types.Point(z=location.point.z + 2))
pipette.move_to(above_location)
# Go downwards and dispense
pipette.dispense(volume, location)
# Go upwards to avoid smearing
pipette.move_to(above_location)
# Helper function (color location)
def location_of_color(color_string):
for well,color in well_colors.items():
if color.lower() == color_string.lower():
return temperature_plate[well]
raise ValueError(f"No well found with color {color_string}")
# Print pattern by iterating over lists
for i, (current_color, point_list) in enumerate(point_name_pairing):
# Skip the rest of the loop if the list is empty
if not point_list:
continue
# Get the tip for this run, set the bacteria color, and the aspirate bacteria of choice
pipette_20ul.pick_up_tip()
max_aspirate = int(18 // POINT_SIZE) * POINT_SIZE
quantity_to_aspirate = min(len(point_list)*POINT_SIZE, max_aspirate)
update_volume_remaining(current_color, quantity_to_aspirate)
pipette_20ul.aspirate(quantity_to_aspirate, location_of_color(current_color))
# Iterate over the current points list and dispense them, refilling along the way
for i in range(len(point_list)):
x, y = point_list[i]
adjusted_location = center_location.move(types.Point(x, y))
dispense_and_jog(pipette_20ul, POINT_SIZE, adjusted_location)
if pipette_20ul.current_volume == 0 and len(point_list[i+1:]) > 0:
quantity_to_aspirate = min(len(point_list[i:])*POINT_SIZE, max_aspirate)
update_volume_remaining(current_color, quantity_to_aspirate)
pipette_20ul.aspirate(quantity_to_aspirate, location_of_color(current_color))
# Drop tip between each color
pipette_20ul.drop_tip()
Unfortunately I am having issues on google colab and cannot run the simulation. Find my colab here. I will try again. I keep following the errors but i am a bit lost.
More designs I made!
our grid plate looks amazing on ronans website!
I made this for a dear friend <3 You can find it here.
The grid looks amazing!!!! I also imported a png picture of a cute rainbow i found online and then added more points or edited out existing ones on ronans website!
This design had waaaay to many points and the code was 30 pages long. It has 7 colours or something like this!
Post-Lab Questions — DUE BY START OF FEB 24 LECTURE
One of the great parts about having an automated robot is being able to precisely mix, deposit, and run reactions without much intervention, and design and deploy experiments remotely.
For this week, we’d like for you to do the following:
Find and describe a published paper that utilizes the Opentrons or an automation tool to achieve novel biological applications.
I found 2 papers but none of them uses opentrons particularly. I am interested in bacterial and textile dyes.
is this amazing paper on DIY liquid handling robots for integrated STEM education and life science research.
Here you can find the second paper on Automated phenotyping of microalgae: scalable solution for high-throughput analysis.
Write a description about what you intend to do with automation tools for your final project. You may include example pseudocode, Python scripts, 3D printed holders, a plan for how to use Ginkgo Nebula, and more. You may reference this week’s recitation slide deck for lab automation details.
While your description/project idea doesn’t need to be set in stone, we would like to see core details of what you would automate. This is due at the start of lecture and does not need to be tested on the Opentrons yet.
Example 1: You are creating a custom fabric, and want to deposit art onto specific parts that need to be intertwined in odd ways. You can design a 3D printed holder to attach this fabric to it, and be able to deposit bio art on top. Check out the Opentrons 3D Printing Directory.
Example 2: You are using the cloud laboratory to screen an array of biosensor constructs that you design, synthesize, and express using cell-free protein synthesis.
Echo transfer biosensor constructs and any required cofactors into specified wells.
Bravo stamp in CPFS reagent master mix into all wells of a 96-well / 384-well plate.
Multiflo dispense the CFPS lysate to all wells to start protein expression.
PlateLoc seal the plate.
Inheco incubate the plate at 37°C while the biosensor proteins are synthesized.
XPeel remove the seal.
PHERAstar measure fluorescence to compare biosensor responses.
For my final project I would be interested in making a printer or a diy dye handling machine that works with natural or bacterial dyes and prints directly on fabric or maybe make an open source one. I think I need a bit more time to find more opentrons examples in textile dyeing!
Final Project Ideas — DUE BY START OF FEB 24 LECTURE
To be completely honest I am more interested in natural and bacterial dyes, food and crystallisation more than ever. My personal work reflects this. I have a lot of ideas but I will try stick to these even though I want to focus more on edible delights, food, bacterial and natural dyes and pigments.
My final project idea number one explores the mining of colour inducing bacteria from the human microbiome for food, cosmetics, the production of sustainable textile dyes and other natural fibres such as human hair, natural weaving material such as straw, palm tree leaves etc.
here is me using my DIY inoculation loop that I designed and printed to inocilate some Janthinobacterium lividum bacteria that produces the
Violacein pigment and give off a Purple colour
According to this paper these are the pigment producing bacteria.
Color-producing bacteria exist in various environments, including on human skin, in water, and in soil, where they produce pigments as a survival mechanism against UV radiation, oxidative stress, or to compete with other microbes. These bacteria, often found in the human skin microbiome, produce natural, biodegradable, and often non-toxic pigments such as carotenoids (yellow/red/orange), violacein (purple), prodigiosin (red), and melanin (black/brown).
Key Color-Producing Bacteria on Human Skin
Staphylococcus aureus (Golden Yellow): Produces staphyloxanthin, a carotenoid pigment that gives it a golden color. This pigment acts as an antioxidant, helping the bacterium withstand oxidative bursts from human immune cells.
Micrococcus luteus (Yellow): Frequently found on human skin, this bacterium produces yellow carotenoid pigments that can absorb UV radiation.
Pseudomonas aeruginosa (Blue-Green): Often found in infections (e.g., burns, wounds), it produces pyocyanin (blue-green) and pyoverdine (yellow-green).
Corynebacterium species (Various/Creamish): Some species in the skin microbiome produce pigments like indogoidine (blue).
Streptococcus agalactiae (Orange-Red): Known to produce a pigment called granadaene, which is linked to its virulence.
Common Pigments and Their Sources
Prodigiosin (Red): Produced by Serratia marcescens, a bacterium that can be found on skin or in the environment.
Violacein (Purple): Produced by Chromobacterium violaceum and Janthinobacterium lividum, these are found in water and soil, but sometimes on skin.
Melanin (Black/Brown): Produced by various bacteria, including Pseudomonas and Bacillus species, providing photoprotection.
Significance to Humans
Clinical Diagnosis: The distinct colors of these bacteria on agar plates are used in clinical labs for rapid identification (e.g., the “golden” S. aureus).
Skin Health/Pathogenesis: Pigments like staphyloxanthin help pathogens evade the immune system, acting as virulence factors.
Industrial/Medical Applications:
i. Textiles: Bacteria like Janthinobacterium lividum are used to dye fabrics (silk, cotton, wool) with natural purple colors.
ii. Cosmetics/Medicine: Bacterial pigments are being researched as natural, UV-protective ingredients for sunscreens and as anti-cancer agents.
iii. Food: Some, like prodigiosin, are explored for use as natural food colorants, though many are still under study for safety.
These pigments are not just for color; they are essential for bacterial survival under stress.
I have a few ideas on how I can work with this concept based on the significance to humans section above. Just like natural pigments I suspect that you can also create a fully circular system with utilising bacterial pigments too.
Here you can find my own open source resource that I created for my students for a zero waste circular journey in natural dyes! I am interested in this model for my project idea too.
Here is a screenshot of the circular system design. I did not design it. Its Cecilia Raspanti of textile lab in Waag academy that did for fabricademy.
My second idea that is again based on circularity is A domestic DIY mycelium lab for breaking down household single use plastics
I asked chatgpt to make me a picture but this is not my vision to be honest. I did not imagine my domestic diy mycelium lab like this.
Inspired by this project called Fungi mutarium (2011) by Katharina Unger, recycles plastic while growing edible treats. It is a prototype system that uses fungi to grow edible biomass (mycelium) on plastic waste. The process involves placing plastic in agar cups (“FU”) filled with fungi. The aim of Livin Studio’s project is to use commonly uneaten parts of fungi to break down plastic while simultaneously producing a novelty food product.
She began working with two widely consumed types of fungus: Pleurotus Ostreatus, more commonly known as Oyster Mushroom and found on Western supermarket shelves, and Schizophyllum Commune, colloquially named Split Gill that is eaten in Asia, Africa and Mexico.
Producing edible treats from this process adds more dimensions to the project and creates a zero waste circular journey adding to the circularity of the system explored <3 I LOVE THIS PROJECT AND I HAD THIS IDEA OF MAKING EDIBLE FUNGI SCAFFOLDS MYSELF. MORE LINKS COMING SOON!
Single-use plastics are goods that are made primarily from fossil fuel–based chemicals (petrochemicals) and are meant to be disposed of right after use—often, in mere minutes. Single-use plastics are most commonly used for packaging and serviceware, such as bags, bottles, wrappers, and straws.
Single use plastics
PET (Polyethylene Terephthalate): Used for drink bottles, water bottles, and food containers.
HDPE (High-Density Polyethylene): Found in milk jugs, shampoo bottles, and sturdy, often reusable shopping bags.
LDPE (Low-Density Polyethylene): Used for flexible plastics like cling wrap, bread bags, and grocery bags.
PP (Polypropylene): Common in microwaveable food containers, yogurt tubs, potato chip bags, and bottle caps.
PS (Polystyrene) & EPS (Expanded Polystyrene): Used for disposable cutlery, plates, cups, and foam food packaging.
As well as recycling nutrients and helping plants and crop grow efficiently, fungi provide us with compounds that produce antibiotics, statins for treating cholesterol and immunosuppressants. Fungarium projects like at Kew Gardens, focused on breaking down plastic, often termed mycoremediation, involve using specialized fungi to degrade synthetic polymers into organic matter. Research from institutions like Kew Gardens and various university teams has identified fungi capable of breaking down plastics—specifically polyurethane and polypropylene—in a matter of weeks, rather than centuries.
Kew Gardens Research: Scientists are mapping the “terrestrial plastisphere” to identify how fungal enzymes can degrade common, hard-to-recycle plastics.
Dr Irina Druzhinina has been studying hundreds of fungal species, as well as bacteria, that make their home on the surface of plants like Welwitschia and certain palms. What makes these plants interesting is their thick, waxy leaf cuticles made of polymers with remarkably similar traits to plastic. To avoid being swept away from their leaf surface home by the elements, fungi secrete enzymes that digest waxy leaf polymers, allowing for better grip. If they can easily digest plant polymers, it stands to reason they may have some ability to digest plastic too. Already, Irina and her international collaborators have identified more than 180 species whose enzymes could digest basic plastics in a lab setting. Identifying the genes associated with this ability and making use of a huge new fungal DNA dataset, could accelerate the finding of other fungi with plastic-eating potential far more quickly than we can now. A fungus-based solution to the enormous issue of plastic pollution could be just years away.
here is Kew gardens fungarium collection <3
and a beautiful video by Katharina Unger on her process for Fungi mutarium
My third idea is a wearable microfluidic sweat collector and biosensor that enables the detection of hormones and endocrine-disrupting chemicals (EDC), including xenoestrogens.
Here is a video from Gao Research Group on their Wearable Estrogen Sensor
In addition, there is a portable sensor that could detect PFAS on site. Led by PhD student Henry Bellette and Dr Saimon Moraes Silva, Director of La Trobe’s Biomedical and Environmental Sensor Technology (BEST) Research Centre, the research has been published in the journal ACS Sensors.
“Most PFAS testing relies on expensive laboratory equipment and specialist analysis, which makes regular monitoring difficult,” he said.
“This biosensor could be used on site and provides a simple yes or no result, allowing water to be screened quickly and easily.”
As you can see on the top section of the page i added some more microfluidics research based on sweat collection <3
Paper microfluidics are also very fun to do at a DIY level. I read this paper!
Another amazing example on paper microfluidics is the 3D Paper Mmicrofluidic Device Fabricated by Embossing fabricated on two layers of omniphobic paper containing different microchannels. Liquids flowing on the upper layer get transfer to the layer underneath to avoid mixing.
