Week 1 HW: Principles and Practices

Describe a biological engineering application or tool you want to develop and why.

Virus Hunting

The usage of virus hunting to discover viruses in animal populations that might become a pandemic and exploit it as a gene therapy tool. first of all the viruses are isolated from hosts of interest, then sequencing their genome, then characterize the virus. Following steps will be:

1. Developing arrays for the virus detection providing a faster and cheaper way.
2. Exploiting the virus replication machinery to deliver compounds / biopharmaceuticals to humans or animals.

Disocvering potential pandemic pathogens early will prevent its outbreak and prepare us well.

Describe one or more governance policy goals related to ensuring this application contributes to an ethical future & prevents harm.

• Biosafety and biosecurity aims to prevent loss, theft and misuse of highconsequence material. This can be done by providing and implementing risk control measures that address the risks associated with conducting high-consequence research and working with high-consequence material, including other biosecurity-relevant material.

• The intrinsic risks of working with biological agents are not only of a biosafety nature, such as exposure or unintentional release, but also of biosecurity, which includes the theft, misuse, or intended release of biological material.

Describe at least three different potential governance actions by considering the purpose, design, assumptions, and risks of failures & “success”

1. Development of a board to organize and authorize the suitable scientist for conducting virus hunting

• Purpose: The aim is to allow only trained professionals to conduct such procedures
• Design: Every country will have a trusted board that will allow and oversee the virus hunting procedures and these boards will be under the supervision of a central board that will get periodic reports
• Assumptions: Incorrect selection of personnel might lead to inproper viral isolation and process organization leading to its outbreak
• Risks of Failures & Success: This action might fall if not properly implemented

2. Development of an agreed upon method of biological materials disposal

• Purpose: The aim is to control and oversee disposal methods to prevent any outbreaks
• Design: Professionals will be further trained
• Assumptions: Ignoring the right protocol for disposal may lead to an outbreak
• Risks of Failures & Success: not providing the right training and control

3. Providing enough funds to conduct the required procedures in the countries of interest

• Purpose: this action aim to fund labs at developing countries of interest
• Design: The organization will provide the fund and supervise its implementation to buy the right equipment and tools
• Assumption: Corruption or not providing the fund will hinder the virus hunting procedures in that country
• Risk of Failures & Success: Not providing enough funds will stop the required procedures

Score each of your governance actions against your rubric of policy goals.

Based on scores, describe which governance option or combination of options, you would prioritize, and why.

Based on the scores:

• I would prioritize the formation of the board because it is the base upon which every other step will follow.
• I would prioritize as well providing enough funds especially for developing countries in which many have the knowledgeable scientists but not enouhg funds for buying the necessary equipment.

References

Hunting for the next pandemic virus (no date) ASM.org. Available at: https://asm.org/magazine/2022/fall/hunting-for-the-next-pandemic-virus

Vaidyanathan, G. (2011) ‘Virus hunters: Catching bugs in the field’, Cell, 147(6), pp. 1209–1211. doi:10.1016/j.cell.2011.11.037.

World Health Organization. Available at: https://iris.who.int/

Week 2 HW: DNA Read, Write and Edit

Part 0: Attend or watch all lecture and recitation videos.

Part 1: Benchling & In-silico Gel Art

• Make a free account at benchling.com
• Import the Lambda DNA.
• Simulate Restriction Enzyme Digestion with the following Enzymes:
  • EcoRI
  • HindIII
  • BamHI
  • KpnI
  • EcoRV
  • SacI
  • SalI
• Create a pattern/image in the style of Paul Vanouse’s Latent Figure Protocol artworks.

• I imagine the pattern as a hand making number one

Part 3: DNA Design Challenge

1. Choose your protein.

• I chose tau protein that it’s hyperphosphorylation is involved in Alzheimer’s disease progression
• I chose UniProt to get its sequence

Reference: https://rest.uniprot.org/uniprotkb/P10636.fasta

2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.

• Tau Protein DNA Sequence:

atggcggaaccgcgccaggaatttgaagtgatggaagatcatgcgggcacctatggcctg ggcgatcgcaaagatcagggcggctataccatgcatcaggatcaggaaggcgataccgat gcgggcctgaaagaaagcccgctgcagaccccgaccgaagatggcagcgaagaaccgggc agcgaaaccagcgatgcgaaaagcaccccgaccgcggaagatgtgaccgcgccgctggtg gatgaaggcgcgccgggcaaacaggcggcggcgcagccgcataccgaaattccggaaggc accaccgcggaagaagcgggcattggcgataccccgagcctggaagatgaagcggcgggc catgtgacccaggaaccggaaagcggcaaagtggtgcaggaaggctttctgcgcgaaccg ggcccgccgggcctgagccatcagctgatgagcggcatgccgggcgcgccgctgctgccg gaaggcccgcgcgaagcgacccgccagccgagcggcaccggcccggaagataccgaaggc ggccgccatgcgccggaactgctgaaacatcagctgctgggcgatctgcatcaggaaggc ccgccgctgaaaggcgcgggcggcaaagaacgcccgggcagcaaagaagaagtggatgaa gatcgcgatgtggatgaaagcagcccgcaggatagcccgccgagcaaagcgagcccggcg caggatggccgcccgccgcagaccgcggcgcgcgaagcgaccagcattccgggctttccg gcggaaggcgcgattccgctgccggtggattttctgagcaaagtgagcaccgaaattccg gcgagcgaaccggatggcccgagcgtgggccgcgcgaaaggccaggatgcgccgctggaa tttacctttcatgtggaaattaccccgaacgtgcagaaagaacaggcgcatagcgaagaa catctgggccgcgcggcgtttccgggcgcgccgggcgaaggcccggaagcgcgcggcccg agcctgggcgaagataccaaagaagcggatctgccggaaccgagcgaaaaacagccggcg gcggcgccgcgcggcaaaccggtgagccgcgtgccgcagctgaaagcgcgcatggtgagc aaaagcaaagatggcaccggcagcgatgataaaaaagcgaaaaccagcacccgcagcagc gcgaaaaccctgaaaaaccgcccgtgcctgagcccgaaacatccgaccccgggcagcagc gatccgctgattcagccgagcagcccggcggtgtgcccggaaccgccgagcagcccgaaa tatgtgagcagcgtgaccagccgcaccggcagcagcggcgcgaaagaaatgaaactgaaa ggcgcggatggcaaaaccaaaattgcgaccccgcgcggcgcggcgccgccgggccagaaa ggccaggcgaacgcgacccgcattccggcgaaaaccccgccggcgccgaaaaccccgccg agcagcggcgaaccgccgaaaagcggcgatcgcagcggctatagcagcccgggcagcccg ggcaccccgggcagccgcagccgcaccccgagcctgccgaccccgccgacccgcgaaccg aaaaaagtggcggtggtgcgcaccccgccgaaaagcccgagcagcgcgaaaagccgcctg cagaccgcgccggtgccgatgccggatctgaaaaacgtgaaaagcaaaattggcagcacc gaaaacctgaaacatcagccgggcggcggcaaagtgcagattattaacaaaaaactggat ctgagcaacgtgcagagcaaatgcggcagcaaagataacattaaacatgtgccgggcggc ggcagcgtgcagattgtgtataaaccggtggatctgagcaaagtgaccagcaaatgcggc agcctgggcaacattcatcataaaccgggcggcggccaggtggaagtgaaaagcgaaaaa ctggattttaaagatcgcgtgcagagcaaaattggcagcctggataacattacccatgtg ccgggcggcggcaacaaaaaaattgaaacccataaactgacctttcgcgaaaacgcgaaa gcgaaaaccgatcatggcgcggaaattgtgtataaaagcccggtggtgagcggcgatacc agcccgcgccatctgagcaacgtgagcagcaccggcagcattgatatggtggatagcccg cagctggcgaccctggcggatgaagtgagcgcgagcctggcgaaacagggcctg

Reference https://www.bioinformatics.org/sms2/rev_trans.html

3. Codon optimization.
   • Codon optimization is conducted to increase the efficiency of expression. For example, although each amino acid has more than one codon, their efficiency varies, therefore, the optimization aims to choose the most efficient codons for increased translation efficiency and stable mRNA structure.
   • I chose E.coli to optimize the codon for, because it of its fast replication and versatile applications
   • Tau Protein DNA sequence with Codon-Optimization
   • Tau protein optimized coding sequence

GC=59.89%, CAI=0.90

ATGGCGGAACCGCGCCAGGAGTTCGAAGTGATGGAAGATCATGCGGGCACCTATGGCCTGGGCGATCGTAAAGATCAGGGCGGCTACACGATGCATCAGGATCAGGAAGGCGATACCGATGCAGGCCTGAAAGAAAGCCCGCTGCAGACCCCGACCGAAGATGGTAGCGAAGAACCGGGCAGCGAAACCAGCGATGCGAAAAGCACCCCGACCGCCGAAGATGTTACCGCCCCTTTAGTGGATGAAGGCGCGCCGGGCAAACAGGCGGCGGCCCAGCCGCATACCGAAATTCCGGAAGGCACGACCGCGGAAGAAGCGGGCATTGGCGATACCCCGAGCCTGGAAGATGAAGCAGCGGGTCACGTGACCCAGGAACCGGAAAGCGGCAAAGTTGTGCAGGAAGGCTTTCTGCGCGAGCCGGGACCGCCCGGCCTGAGCCATCAACTGATGAGCGGCATGCCGGGTGCGCCGTTACTGCCGGAAGGCCCGCGCGAAGCCACCCGCCAGCCGAGCGGCACGGGCCCGGAAGATACCGAAGGCGGCCGTCATGCGCCGGAACTGCTGAAACATCAGCTGCTGGGCGATCTGCATCAGGAAGGCCCGCCGCTGAAAGGCGCGGGTGGCAAAGAACGTCCGGGCAGCAAAGAAGAAGTGGATGAAGATCGTGATGTGGATGAAAGCAGCCCGCAGGATAGCCCGCCGAGCAAAGCCAGCCCGGCCCAGGATGGCCGTCCGCCGCAAACCGCGGCACGTGAAGCCACCTCAATTCCGGGCTTCCCGGCGGAAGGCGCGATTCCGCTGCCGGTGGATTTCCTGAGCAAAGTGAGCACCGAAATTCCGGCGAGCGAACCGGATGGCCCGAGCGTGGGTCGCGCCAAAGGCCAGGATGCGCCGCTGGAATTCACCTTTCATGTGGAAATTACCCCGAACGTGCAGAAAGAACAGGCGCATAGCGAAGAGCATCTGGGACGCGCGGCCTTTCCGGGCGCGCCGGGTGAAGGTCCGGAAGCGCGCGGTCCGTCTCTGGGCGAAGATACGAAAGAAGCGGATCTGCCGGAACCGAGCGAAAAACAGCCGGCGGCGGCGCCGCGCGGTAAACCGGTGAGCCGCGTTCCGCAACTGAAAGCGCGCATGGTTTCGAAATCAAAAGATGGCACGGGCAGCGACGATAAAAAAGCCAAAACCAGCACCCGCAGCAGTGCCAAAACCCTGAAAAACCGCCCGTGCCTGAGCCCGAAACATCCGACGCCGGGCAGCAGCGATCCGCTGATTCAGCCGAGCTCTCCGGCGGTTTGTCCTGAACCGCCGTCAAGTCCGAAATATGTTAGCAGCGTTACCAGCCGCACCGGCTCAAGCGGCGCCAAAGAAATGAAACTGAAAGGTGCCGATGGTAAAACTAAAATTGCGACCCCGCGCGGCGCGGCCCCGCCGGGCCAGAAAGGCCAGGCGAACGCAACCCGCATTCCGGCGAAAACCCCGCCGGCGCCGAAAACCCCGCCGAGTTCAGGTGAACCGCCGAAAAGCGGCGATCGCTCAGGCTATAGTAGCCCGGGCAGCCCGGGGACCCCGGGCAGCCGTTCACGTACCCCGAGCCTGCCGACCCCGCCGACTCGTGAACCGAAAAAAGTCGCCGTGGTACGCACCCCGCCGAAAAGCCCGTCGTCGGCGAAAAGCCGCCTGCAGACCGCGCCGGTTCCGATGCCGGATCTGAAAAATGTGAAAAGCAAAATTGGCTCTACCGAAAACCTGAAACACCAGCCGGGAGGCGGCAAAGTGCAAATCATTAATAAAAAACTGGATCTGTCAAACGTGCAATCAAAATGCGGTTCGAAAGATAACATTAAACATGTTCCGGGTGGCGGCTCGGTGCAGATTGTGTATAAACCCGTGGATCTGAGCAAAGTTACCTCGAAGTGTGGATCTCTGGGCAATATCCATCATAAACCGGGCGGCGGCCAGGTTGAAGTTAAATCTGAAAAACTGGATTTTAAAGATCGCGTGCAGAGCAAAATTGGCAGCCTGGATAATATCACCCATGTGCCGGGCGGCGGCAACAAAAAAATTGAAACCCATAAACTGACCTTTCGCGAAAATGCCAAAGCGAAAACCGATCACGGTGCGGAAATTGTTTATAAAAGCCCGGTTGTTAGCGGTGATACGAGCCCGCGTCATCTGTCGAACGTTAGCTCAACCGGTAGCATTGATATGGTGGATAGCCCGCAACTGGCGACGCTGGCCGATGAAGTGTCGGCGTCCCTGGCGAAACAGGGTCTG

Reference: https://en.vectorbuilder.com/tool/codon-optimization/6781bd12-7b93-4071-a97a-e6f9b8f17287.html

Part 4: Prepare a Twist DNA Synthesis Order

1. Create a Twist account and a Benchling account [DONE]
2. Build Your DNA Insert Sequence

Sharing link in Benchling: https://benchling.com/s/seq-LWrWyNWwQivMCCt0o4Ra?m=slm-qbMaWSkeMRm5NZ7JzEJw

• SBOL Image

• after uploading the sequence in twist, I optimized it more in twist

• sharing link after exporting to benchling https://benchling.com/s/seq-wNOy6J9WVuWzZ1i4URkY?m=slm-Gj8tRUDvFaVLFxjZZbbn

• image of the constructed plasmid

Part 5: DNA Read/Write/Edit

DNA Read

1. What DNA would you want to sequence (e.g., read) and why?

• The gene I’m interested in is the APP (Amyloid Beta Precursor Protein) Gene, this gene is involved in Alzheimer disease. I chose this gene because I’m interested in using synthetic biology to understand neurodegenerative disorders, especially Alzheimer’s disease.

2. In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why?

• I chose PacBio sequencing technology, it is a third-generation sequencing technology, that have the ability to produce long and higly accurate DNA reads. It is based on single molecule real-time (SMRT) sequencing principle.
• for preparing the input, the DNA is prepared into the SMRTbell library by ligating hairpin adapters to double-stranded DNA on both ends, forming a circular template. Primers and polymerases are added to this library, which is loaded onto the sequencing instrument that contains the SMRT Cell and ZMWs. A single template DNA is immobilized in each ZMW. As the polymerase adds fluorescently labeled nucleotides into the growing DNA strand, light is emitted. This light emission is measured in real time and these signals are converted into nucleotide sequences.
• the first step is library costruction which involves several steps to prepare DNA for sequencing:
  • DNA is cleaved into fragments of the desired size and it undergoes end repair.
  • Then, adaptors with hairpin structures are ligated to both ends of the DNA fragments which creates single-stranded circular structures called SMRTbell templates.
  • Finally, the templates are purified and loaded onto the PacBio sequencing instrument.
• the output is fluorescent signals that are translated into base sequences then alignment and assembly are conducted

DNA Write

1. What DNA would you want to synthesize (e.g., write) and why?

• I would synthesize genetic circuit that sense the presence of high amount of hyperphosphorylation in the brain for example.

2. What technology or technologies would you use to perform this DNA synthesis and why?

• I would choose oxford nanopore for synthesizing the genetic circuit.

DNA Edit

1. What DNA would you want to edit and why?

• I would want to edit a gene that have a disease-causing mutation.

3. What technology or technologies would you use to perform these DNA edits and why?

• I would use CRISPR-Cas to edit the gene, the main steps involves designing gRNA that will guide the Cas9 to cut the specific site

Week 3 HW: Lab Automation

Python Script for Opentrons Artwork

I chose to make the egyptian beetle

inspiration

artistic design using the GUI

link: https://opentrons-art.rcdonovan.com/?id=1xb86617h0wq061

then I wrote the Python script which draws my design using the Opentrons.

google colab link: https://colab.research.google.com/drive/1O8__PXIf_-nn57BUFKG7b7a9N-xvNoNj?authuser=2#scrollTo=pczDLwsq64mk&line=1&uniqifier=1

Post-Lab Questions

Final Project Ideas

Week 1 Lab: Pipetting

Individual Final Project

Group Final Project