𓆣 Nourelden Rihan β€” HTGAA Spring 2026 𓆣

cover image cover image

Who am i? π“€€

Hi, I'm Nourelden Rihan (you can call me Nour) :D

I am a Medical Student from Egypt, with a love for code and a heart for Synthetic Biology. I’m here to pivot from treating patients to engineering biology. I believe the most creative solutions happen at the intersection of disciplines.

Off the Clock: I am a nature enthusiast stuck in the city. I dream of going fishing and mountain hiking. If you’ve ever cast a line or summited a peak, please share your stories, I need the inspiration!

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Contact info π“ˆ

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

The Scrolls (Homework) 𓃠

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

The Sanctum (Labs) 𓉐

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

The Monuments (Projects) 𓆣

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Subsections of 𓆣 Nourelden Rihan β€” HTGAA Spring 2026 𓆣

Homework

Weekly homework submissions:

  • 𓃠 Week 1 Homework 𓃠 1. First, describe a biological engineering application or tool you want to develop and why. I want to build a Biological 3D Printer :D It is a quite crazy idea, basically a biological 3D printer takes in a DNA file and prints it and expresses it right away and delivers the target product in vial.
  • 𓃠 Week 2 Homework 𓃠 Part 1: Benchling & In-silico Gel Art Simulate Restriction Enzyme Digestion with the following Enzymes:
  • 𓃠 Week 3 Homework 𓃠 Assignment: Python Script for Opentrons Artwork This is an Ancient Egyptian Pharaoh Figure, this was made using this GUI Also here is the live link to check it out! :D
  • 𓃠 Week 4 Homework 𓃠 Part A. Conceptual Questions π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή References π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή
  • 𓃠 Week 5 Homework 𓃠 Part A (From Pranam) π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή References π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Subsections of Homework

Week 1 HW: Principles and Practices

cover image cover image

𓃠 Week 1 Homework 𓃠

1. First, describe a biological engineering application or tool you want to develop and why.

I want to build a Biological 3D Printer :D It is a quite crazy idea, basically a biological 3D printer takes in a DNA file and prints it and expresses it right away and delivers the target product in vial.

How it works: You download a DNA file (a plasmid sequence) for a specific function, like a molecule that smells like chocolate, or a protein that glows red, or a specific medication. You send the file to the printer, which synthesizes or assembles the genetic instruction, expresses it using a cell-free system or bacterial chassis, and delivers the purified product in a vial.

I want to build this because I want to democratize manufacturing. Right now, biology is locked in big labs. I want to bring ‘Bio-Production’ to the home, the remote clinic, or even a spaceship. If you can email a file, you should be able to print a cure (or a scent).

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Main Goals include:

A. Preventing Malicious Use (Biosecurity): to make sure such printers will not be used to create harmful, toxic or dangerous products or molecules, maybe this can achieved through:

  1. DNA Screening: We can screen the DNA sequence that is requested for printing, to check and prevent the process if it encodes for a dangerous molecule or a viral toxin

  2. Reagent Lock-in: To make sure the reagents, proteins and raw materials in the printer are only viable inside the printer environment and cannot be extracted and used else where

B. End User Safety & Reliability (Biosafety): we need to make sure the printed molecule is exactly what it claims to be, and to make sure no mutation or contamination has occured

  1. Proofreading Mechanism: we can apply a proofreading startegy during and after printing and synthesis to confirm similarity between the printed the DNA and the uploaded DNA file

  2. Proper Elimination of undesired or faulty molecules: we need to be able to safely and properly discard or eliminate mutated or contaminated sequences once identified

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3. Next, describe at least three different potential governance β€œactions” by considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & β€œSuccess”).

A. Action 1: International Regulation & Monitoring: This action can be pursued & applied through international health organizations like WHO and local alikes

  1. Purpose: We can regulate what DNA sequences get printed through a digital signature that has to be approved by such organiztions, and the printer can only print these approved sequences

  2. Design: We can have a main website similiar to the iGEM registry where users can submit new DNA sequences that they want to print and Organizations like the WHO can have a team of scientists + AI that periodically screen new DNA sequences that get submitted and either give it a signature for public use or flag it as Dangerous/Toxic and prevents its printing

  3. Assumptions: We assume that bad people cannot manipulate the signature or bypass its checking before printing

  4. Risks of Failure & Success:

    4a. Failure: Risks include Hackers being able to bypass certain signatures and produce dangerous and harmful products through the printers or even hijacking the printers themselves to allow it to print without checking anything

    4b. Success: If these regulations get applied so strictly, it could possibly lead to a lack of innovation and creativity and less DNA sequences the end users are able to print, Also local regulations would also mean some molecules might be allowed to be printed in one country and not allowed in another

B. Action 2: Companies Regulation: This Regulation is applied through the parent company that sells the printers

  1. Purpose: We can regulate the usage printers reagents and chemicals and make sure it only uses certified or accepted reagents, more like printers cartridge system or coffee pods, mainly to make sure users can’t take the reagents and use it elsewhere

  2. Design: The company can design the printer and cartridge so that they become dependant on each other, maybe the reagents need an activation factor that is only in the printer system or hardware so that without it, the reagents are dormant and cant be used

  3. Assumptions: We assume the chemical “lock” is not breakable by other chemistry sets, we also assume users can afford the prices of the printer reagent cartridges

  4. Risks of Failure & Success:

    4a. Failure: Risks include bad people managaing to break the chemical formula and use the reagents in other probably malicious work

    4b. Success: Monopoly, if one company produces those reagents and it can increase prices or stop selling to specifc countries or competitors for company gains

C. Action 3: Community Integration & Bio Bug Bounty Programs: This action involves both the companies and the community for a shared safe future

  1. Purpose: Integrate the Community into the process through lectures and workshops about proper usage of the printers, how to deal with malfunctions, how to submit DNA designs and the application of Bug Bounty incentive programs to quickly and effictevly patch errors, faults or flaws in the printer’s software and hardware

  2. Design: Incentives can be offered to people who can bypass certain security checks in the printer or print a certain toxic molecule that the print is not supposed to print, this helps turn possible hackers into quality assurance testers.

  3. Assumptions: We assume the bounty hunters will report all findings and that the incentive given is enough to make sure they report to us.

  4. Risks of Failure & Success:

    4a. Failure: A bounty hunter discovers a major defect in the printer but recieves a bigger incentive from another competitor or bad groups and delivers the information to them instead

    4b. Success: It is actually hard to think of one. maybe all these trials and errors and bug hunting will make the printer model known and allow for competitors to start companies and compete with us

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

4. Next, score (from 1-3 with, 1 as the best, or n/a) each of your governance actions against your rubric of policy goals. The following is one framework but feel free to make your own:

Does the option:Action 1Action 2Action 3
Enhance Biosecurity
β€’ By preventing incidents111
β€’ By helping respond3n/a2
Foster Lab Safety
β€’ By preventing incident122
β€’ By helping respond3n/a3
Protect the environment
β€’ By preventing incidents122
β€’ By helping respond3n/a2
Other considerations
β€’ Minimizing costs and burdens to stakeholders331
β€’ Feasibility?112
β€’ Not impede research222
β€’ Promote constructive applications211
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

5. Last, drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why. Outline any trade-offs you considered as well as assumptions and uncertainties

Based on the scoring matrix, I recommend a Hardware-First, Software-Verified Hybrid Strategy, prioritizing Action 1 (Digital Screening) as the immediate standard, supported by Action 2 (Reagent Lock).

Hardware is the Hardest Barrier, Software can be hacked, and Bounties are reactive and takes a while to build community knowledge. Physical reagent cartridges is a very robust fail-safe for preventing accidental contamination or malicious misuse by non-experts, however reagents can be found elsewhere and maybe chemically designed to imitate the proposed solutions, so having signatured DNA sequences remain the most reliable approach.

These actions however carry tradeoffs that include lack of creative space for other users to design DNA sequences they like and have to go through a rigrous application process to get approved and signatured, and the Reagent Lock risks Company Monopoly if it is allowed to be the sole producer of these types of reagents.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

6. Reflecting on what you learned and did in class this week, outline any ethical concerns that arose, especially any that were new to you. Then propose any governance actions you think might be appropriate to address those issues. This should be included on your class page for this week.

One of the ethical concerns that arose to me is how “Open Source” in this setting can actually do more harm than good, if a lab builds a toxic molecule or a virus using the printer in a closed setting, we can basically lock up and quarantine the lab, but with open source, if the process goes online on the internet, there is no going back, and now anyone can have it. this ties back to the importance of the proposed Signature only printing action, as it can help mitigate the effects of distributed dangerous DNA sequences and trying to print it, maybe also we will need to make these printers Online only, so proper monitoring of what is being printed and by whom, of course users must be informed of this and be allowed to either accept such terms to buy the printer and use our products or refuse, and in the case of refusal, and taking biosecurity into consideration, the products should not be sold to the user nor permitted for use in this case

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

𓃠 Week 2 Lecture Prep 𓃠

1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome. How does biology deal with that discrepancy?

The error rate for polymerase is 1:106. The Human Genome is ~ 3.2 Gbp, doing the math means that it makes 3200 errors each time which is alot. Biology deals with these errors through proofreading and corrections, one example is the MutS Repair System where it fixes the mismatches and repairs them using DNA polymerase and Ligase

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

2. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest?

An Average human protein can be up to 1036 bp, each 3 (called a codon) codes for an amino acid, but amino acids can be coded by many combinations in those codons, making the different ways to code for the average human protein way too much and increases exponentially. In practice, the many of these theoretical coding sequences do not work well since the nucleotide sequence determines the physical behavior of the mRNA molecule. One of the reasons is formation of mRNA secondary structures, such as hairpins and loops, which are governed by the “Minimum Free Energy” of the sequence. Other reasons include that specific nucleotide patterns can create recognition sites for cellular enzymes like RNase, leading to in vivo cleavage and the destruction of the mRNA before it can be translated

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3. What’s the most commonly used method for oligo synthesis currently?

The phosphoramidite method performed via Solid-Phase Synthesis of Oligos is the current most common method. It starts with phosphoramidite Coupling then Capping of unreacted sites followed by Oxidation and then Deblocking. These steps are then repeated for as much times needed for the synthesis

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

4. Why is it difficult to make oligos longer than 200nt via direct synthesis?

(Had to look up more info about this topic using AI) It mainly returns to difficulties regarding Yield, Truncation Products and Depurination. The longer the synthesized chain gets, the lower the yield gets, and it is not uniform but exponential. Additionally Long Chains accumalate Truncation Products which may happen because of errors or depurination from acids added during the synthesis stage. On the bright side, Twist Bioscience has came up with an Enhanced Process & Chemistry allowing PCR yield to go up to >10 fold increase, 1:2000 error rate and acheiving a 500bp Oligos

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

5. Why can’t you make a 2000bp gene via direct oligo synthesis?

This touches back to the previous question, with exponential Yield Decay, a 2000bp gene would have a very tiny yield, making most of the produced bases possibly junk, also the depurination issue arises, because the base pairs at the very beginning of the chain will need to resist and endure the acids added in the Deblocking phase up to 2000 times which is difficult. The current process of creating the 2000bp gene would creating multiple oligos (200bp - 500bp) and stitching them together using DNA ligase.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

6. [(Advanced students)] Given the one paragraph abstracts for these real 2026 grant programs sketch a response to one of them or devise one of your own:

I chose the Smart-RBC: Smart Red Blood Cells Grant

My Proposal: The “Oxygen Turbo Cell”

The Idea: I propose creating a “High-Performance” Red Blood Cell that acts like a backup oxygen tank for hikers, firefighters or Rescue teams in extreme conditions. We can engineer the RBCs’ Heamoglobin to be much more sensetive to markers that arise in low oxygen or hypoxic settings.

To work it should have a biosensor that can detect Lactic Acid, which is the acid that gets produced in low oxygen settings and causes the burning sensation in your muscles when you run and once the cell senses high acid levels, the engineered haemoglobin gets activated and lets go of even more oxygen that it normally would creating a higher oxygen surge instantly into the muscles or brain to properly and rapidly accomodate to the new environment. Since these cells have no nucleus or DNA (Enuculated), they are just temporary “smart delivery bags”, They circulate for a few weeks to keep the hiker safe, then naturally die off without changing the hiker’s permanent genetics.

This also solves the “Natural Acclimation Time” problem mentioned in the abstract. Instead of waiting weeks for the body to get used to high altitude, or low oxygen environments, a person can receive a transfusion of these “Oxygen Turbo Cells” and be ready immediately to tackle these extreme environments and this applies to what the abstract mentioned as “enhance physiological resilience”.

AI citation: i used Gemini to help with idea validation and properly tying it back to match the requirements of the Grant Program

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Week 2 HW: DNA Read, Write, & Edit

cover image cover image

𓃠 Week 2 Homework 𓃠

Part 1: Benchling & In-silico Gel Art

  • Simulate Restriction Enzyme Digestion with the following Enzymes: Virtual Digest of Lambda DNA using a bunch of Restriction Enzymes Virtual Digest of Lambda DNA using a bunch of Restriction Enzymes

  • Create a pattern/image in the style of Paul Vanouse’s Latent Figure Protocol artworks. A Smiley Face Drawn using Benchling’s Virtual Digest A Smiley Face Drawn using Benchling’s Virtual Digest

    • I tried to do a smiley face and it turned out so bad but i love it XD!
    • Many thanks to Ronan for his Website, it really helped alot make this much faster!
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Part 3: DNA Design Challenge

3.1. Choose your protein.

Hemocyanin. It is a giant, copper-based protein that functions as the respiratory pigment for many mollusks and arthropods, but the coolest thing is that when their blood is oxygenated it turns into Blue :D. Unlike our iron-based hemoglobin which is packed inside cells, hemocyanin floats freely in the hemolymph of animals like the Atlantic Horseshoe Crab and the Keyhole Limpet. It is a medical powerhouse for humans; its massive, alien structure provokes a strong immune response, making it an effective immunotherapy treatment for bladder cancer and a crucial carrier protein for vaccines (helping the body recognize small drug molecules) and more (1).

Horseshoe Crab (Limulus polyphemus) Horseshoe Crab (Limulus polyphemus)

Here is a picture of the Horseshoe Crab (Limulus polyphemus) from the National Wildlife Federation (NWF)

Cayenne keyhole limpet (Diodora cayenensis) Cayenne keyhole limpet (Diodora cayenensis)

Here is a picture of the Cayenne keyhole limpet (Diodora cayenensis) from the Bailey-Matthews National Shell Museum & Aquarium

Here is the Hemocyanin Protein Sequence

TLHDKQIRVCHLFEQLSSATVIGDGDKHKHSDRLKNVGKLQPGAIFSCFHPDHLEEARHLYEVFWEAGDFNDFIEIAKEARTFVNEGLFAFAAEVAVLHRDDCKGLYVPPVQEIFPDKFIPSAAINEAFKKAHVRPEFDESPILVDVQDTGNILDPEYRLAYYREDVGINAHHWHWHLVYPSTWNPKYFGKKKDRKGELFYYMHQQMCARYDCERLSNGMHRMLPFNNFDEPLAGYAPHLTHVASGKYYSPRPDGLKLRDLGDIEISEMVRMRERILDSIHLGYVISEDGSHKTLDELHGTDILGALVESSYESVNHEYYGNLHNWGHVTMARIHDPDGRFHEEPGVMSDTSTSLRDPIFYNWHRFIDNIFHEYKNTLKPYDHDVLNFPDIQVQDVTLHARVDNVVHFTMREQELELKHGINPGNARSIKARYYHLDHEPFSYAVNVQNNSASDKHATVRIFLAPKYDELGNEIKADELRRTAIELDKFKTDLHPGKNTVVRHSLDSSVTLSHQPTFEDLLHGVGLNEHKSEYCSCGWPSHLLVPKGNIKGMEYHLFVMLTDWDKDKVDGSESVACVDAVSYCGARDHKYPDKKPMGFPFDRPIHTEHISDFLTNNMFIKDIKIKFHE
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.

accctgcatgataaacagattcgcgtgtgccatctgtttgaacagctgagcagcgcgaccgtgattggcgatggcgataaacataaacatagcgatcgcctgaaaaacgtgggcaaactgcagccgggcgcgatttttagctgctttcatccggatcatctggaagaagcgcgccatctgtatgaagtgttttgggaagcgggcgattttaacgattttattgaaattgcgaaagaagcgcgcacctttgtgaacgaaggcctgtttgcgtttgcggcggaagtggcggtgctgcatcgcgatgattgcaaaggcctgtatgtgccgccggtgcaggaaatttttccggataaatttattccgagcgcggcgattaacgaagcgtttaaaaaagcgcatgtgcgcccggaatttgatgaaagcccgattctggtggatgtgcaggataccggcaacattctggatccggaatatcgcctggcgtattatcgcgaagatgtgggcattaacgcgcatcattggcattggcatctggtgtatccgagcacctggaacccgaaatattttggcaaaaaaaaagatcgcaaaggcgaactgttttattatatgcatcagcagatgtgcgcgcgctatgattgcgaacgcctgagcaacggcatgcatcgcatgctgccgtttaacaactttgatgaaccgctggcgggctatgcgccgcatctgacccatgtggcgagcggcaaatattatagcccgcgcccggatggcctgaaactgcgcgatctgggcgatattgaaattagcgaaatggtgcgcatgcgcgaacgcattctggatagcattcatctgggctatgtgattagcgaagatggcagccataaaaccctggatgaactgcatggcaccgatattctgggcgcgctggtggaaagcagctatgaaagcgtgaaccatgaatattatggcaacctgcataactggggccatgtgaccatggcgcgcattcatgatccggatggccgctttcatgaagaaccgggcgtgatgagcgataccagcaccagcctgcgcgatccgattttttataactggcatcgctttattgataacatttttcatgaatataaaaacaccctgaaaccgtatgatcatgatgtgctgaactttccggatattcaggtgcaggatgtgaccctgcatgcgcgcgtggataacgtggtgcattttaccatgcgcgaacaggaactggaactgaaacatggcattaacccgggcaacgcgcgcagcattaaagcgcgctattatcatctggatcatgaaccgtttagctatgcggtgaacgtgcagaacaacagcgcgagcgataaacatgcgaccgtgcgcatttttctggcgccgaaatatgatgaactgggcaacgaaattaaagcggatgaactgcgccgcaccgcgattgaactggataaatttaaaaccgatctgcatccgggcaaaaacaccgtggtgcgccatagcctggatagcagcgtgaccctgagccatcagccgacctttgaagatctgctgcatggcgtgggcctgaacgaacataaaagcgaatattgcagctgcggctggccgagccatctgctggtgccgaaaggcaacattaaaggcatggaatatcatctgtttgtgatgctgaccgattgggataaagataaagtggatggcagcgaaagcgtggcgtgcgtggatgcggtgagctattgcggcgcgcgcgatcataaatatccggataaaaaaccgatgggctttccgtttgatcgcccgattcataccgaacatattagcgattttctgaccaacaacatgtttattaaagatattaaaattaaatttcatgaa
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3.3. Codon optimization.

I decided to use Benchling’s Codon Optimization for E. Coli K-12. Codon Optimization is important because it uses the amino acids more native to the chosen organism which boosts speed and efficiency of translation and also if it is not done the organism might not have enough complementary tRNA anti codon molecules to synthesize this specific amino acid.

ACCCTGCATGATAAACAGATTCGCGTGTGCCATCTGTTTGAACAGCTGAGCAGCGCGACCGTGATTGGCGATGGCGATAAACATAAACATAGCGATCGCCTGAAAAACGTGGGCAAACTGCAGCCGGGCGCGATTTTTAGCTGCTTTCATCCGGATCATCTGGAAGAAGCGCGCCATCTGTATGAAGTGTTTTGGGAAGCGGGCGATTTTAACGATTTTATTGAAATTGCGAAAGAAGCGCGCACCTTTGTGAACGAAGGCCTGTTTGCGTTTGCGGCGGAAGTGGCGGTGCTGCATCGCGATGATTGCAAAGGCCTGTATGTGCCGCCGGTGCAGGAAATTTTTCCGGATAAATTTATTCCGAGCGCGGCGATTAACGAAGCGTTTAAAAAAGCGCATGTGCGCCCGGAATTTGATGAAAGCCCGATTCTGGTGGATGTGCAGGATACCGGCAACATTCTGGATCCGGAATATCGCCTGGCGTATTATCGCGAAGATGTGGGCATTAACGCGCATCATTGGCATTGGCATCTGGTGTATCCGAGCACCTGGAACCCGAAATATTTTGGCAAAAAAAAAGATCGCAAAGGCGAACTGTTTTATTATATGCATCAGCAGATGTGCGCGCGCTATGATTGCGAACGCCTGAGCAACGGCATGCATCGCATGCTGCCGTTTAACAACTTTGATGAACCGCTGGCGGGCTATGCGCCGCATCTGACCCATGTGGCGAGCGGCAAATATTATAGCCCGCGCCCGGATGGCCTGAAACTGCGCGATCTGGGCGATATTGAAATTAGCGAAATGGTGCGCATGCGCGAACGCATTCTGGATAGCATTCATCTGGGCTATGTGATTAGCGAAGATGGCAGCCATAAAACCCTGGATGAACTGCATGGCACCGATATTCTGGGCGCGCTGGTGGAAAGCAGCTATGAAAGCGTGAACCATGAATATTATGGCAACCTGCATAACTGGGGCCATGTGACCATGGCGCGCATTCATGATCCGGATGGCCGCTTTCATGAAGAACCGGGCGTGATGAGCGATACCAGCACCAGCCTGCGCGATCCGATTTTTTATAACTGGCATCGCTTTATTGATAACATTTTTCATGAATATAAAAACACCCTGAAACCGTATGATCATGATGTGCTGAACTTTCCGGATATTCAGGTGCAGGATGTGACCCTGCATGCGCGCGTGGATAACGTGGTGCATTTTACCATGCGCGAACAGGAACTGGAACTGAAACATGGCATTAACCCGGGCAACGCGCGCAGCATTAAAGCGCGCTATTATCATCTGGATCATGAACCGTTTAGCTATGCGGTGAACGTGCAGAACAACAGCGCGAGCGATAAACATGCGACCGTGCGCATTTTTCTGGCGCCGAAATATGATGAACTGGGCAACGAAATTAAAGCGGATGAACTGCGCCGCACCGCGATTGAACTGGATAAATTTAAAACCGATCTGCATCCGGGCAAAAACACCGTGGTGCGCCATAGCCTGGATAGCAGCGTGACCCTGAGCCATCAGCCGACCTTTGAAGATCTGCTGCATGGCGTGGGCCTGAACGAACATAAAAGCGAATATTGCAGCTGCGGCTGGCCGAGCCATCTGCTGGTGCCGAAAGGCAACATTAAAGGCATGGAATATCATCTGTTTGTGATGCTGACCGATTGGGATAAAGATAAAGTGGATGGCAGCGAAAGCGTGGCGTGCGTGGATGCGGTGAGCTATTGCGGCGCGCGCGATCATAAATATCCGGATAAAAAACCGATGGGCTTTCCGTTTGATCGCCCGATTCATACCGAACATATTAGCGATTTTCTGACCAACAACATGTTTATTAAAGATATTAAAATTAAATTTCATGAA
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3.4. You have a sequence! Now what?

When this protein is introduced to the E. coli K-12, it can start transcribing this DNA into an mRNA then this mRNA can be translated into a protein so that the bacteria can use it, and since we have codon optimized it for the e coli, we should expect a smooth translation process without any stalling.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

3.5. [Optional] How does it work in nature/biological systems?

1) Describe how a single gene codes for multiple proteins at the transcriptional level.

Alternative Splicing. A single Gene in Eukaryotes can code for multiple proteins through a process called Alternative Splicing, It takes on many forms, like Exon Skipping, where a certain exon might be skipped possibly altering the protein function, or Alternative 5’ or 3’ Splicing, where some exons can be longer or shorter hence affecting the number of produced amino acids altering the function too, another way is intron retention where some introns are not spliced out which can introduce a stop codon and can cause the protein to decay using the Nonsense mediated decay pathway.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

2) Try aligning the DNA sequence, the transcribed RNA, and also the resulting translated Protein!!! See example below.

DNA, RNA & AA DNA, RNA & AA

Here is a Picture of the very first few bases of Hemocyanin II DNA, RNA & Amino Acid

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Part 4: Prepare a Twist DNA Synthesis Order

Benchling Linear Map of a Constitutive sfGFP DNA Benchling Linear Map of a Constitutive sfGFP DNA

Here is a screenshot of my Linear map of Constitutive sfGFP DNA and here is the Benchling Link

Final Twist sfGFP Plasmid Final Twist sfGFP Plasmid

Here is a screenshot of my Twist Ready Plasmid :D

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Part 5: DNA Read/Write/Edit

5.1 DNA Read

(i) What DNA would you want to sequence (e.g., read) and why?

I’d like to sequence and read the genome of the Axolotl (Ambystoma mexicanum) to learn more about the process of its limb regeneration and how it happens, and figure out if other species have these genes too whether Human, Marine or Plants.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why?

I would use PacBio SMRT sequencing. This is a third-generation technology, which is perfect because the Axolotl genome is very huge (32 billion bases!) and full of repetitive parts that confuse older, short-read machines. Third-generation sequencing reads single molecules of DNA in real-time, giving us the long reads necessary to bridge those gaps and locate the regeneration genes i care about.

For the process, I’d follow the SMRTbells process where I’d start with really long strands of high-quality DNA and attach hairpin adapters to both ends, turning them into circular loops. These loops go into tiny wells where a polymerase enzyme runs around the circle, adding bases. As each base (A, C, T, G) is added, it gives off a specific colored flash of light. The machine records these flashes to decode the sequence. The final output is HiFi reads: extremely long, highly accurate digital sequences that we can assemble into a full map.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

5.2 DNA Write

(i) What DNA would you want to synthesize (e.g., write) and why?

I want to synthesize the Dsup (Damage Suppressor) gene found in Tardigrades, Tardigrades are famous for surviving the vacuum of space and massive radiation because this specific protein wraps around their DNA like a physical shield to prevent damage. By synthesizing this gene and inserting it into human cells or gut bacteria or plants, I want to see if we can “borrow” this superpower to protect astronauts from lethal cosmic radiation on the long space journies, effectively genetically engineering a radiation protection.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

(ii) What technology or technologies would you use to perform this DNA synthesis and why?

For the DNA synthesis technology, maybe i will rely either on the current common Phosphoramidite DNA synthesis or use an Enzymatic Synthesis using Terminal deoxynucleotidyl transferase (TdT), or maybe an even more easier and more quick method is to just use Twist Bioscience and order the gene right away :D

Basically the steps for phosphoramidite synthesis process would start first with deblocking of the nucleotide then it couples using phosphoramidite, after that we do Capping for the unreacted sites to prevent any faulty chains to continue growing, and then oxidation to seal and empower the bond of our newly added nucleotide, then the process is repeated until we get a chain of N bases, then these Oligos are stitched and assembled together using methods like Gibson Assembly, Golden Gate Assembly or the recently announced Sidewinder (2) way (which is pretty cool :D)

Phosphoramidite Synthesis currently faces the major issue of Exponentially Decaying Yield when the synthesized chain gets longer however Twist Bioscience seems to be doing a really great job regarding this especially for their achievement of direct synthesis of the first 700mer Oligo using “Enhanced Chemistry”. For DNA Assembly currenty Sidewinder (2) seems like a very promising tool that can achieve high accuracy and avoids many of the errors that can happen from long, repititve or high GC content Oligos that methods like Gibson Assembly or Golden Gate Assembly used to suffer from.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

5.3 DNA Edit

(i) What DNA would you want to edit and why?

Quite a crazy idea but i would like to edit the DNA of the E. Coli K-12 and install regeneration genes from the Axolotl to allow the e coli to be able to regrow and detach vesicles containing molecules that it can produce or has been metabolically engineered to produce. this can allow it to match some Yeast ability for storing produced molecules especially hydrophobic molecules. These vesicles can be engineered to float to the top of flask or fermentation tanks which would allow easy extraction and purification.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

(ii) What technology or technologies would you use to perform these DNA edits and why?

I would use CRISPR-Cas9 to edit the genome. The process starts with designing a Guide RNA (gRNA) that acts as a GPS coordinate for the specific location in the E. coli genome where I want to make the edit, then introduce a plasmid into the cells containing the Cas9 enzyme, the gRNA, and a Donor DNA template (which carries the Axolotl genes). The Cas9 enzyme cuts the bacterial DNA at the target site, and the cell repairs this cut using the Donor template, successfully “pasting” the new regeneration genes, this process is called Homology-Directed Repair.

However, this method has limitations, mainly of efficiency and payload size. Inserting large, complex gene pathways is much harder than making small mutations, the larger the DNA insert, the less likely the bacteria are to accept it. There is also the risk of off-target effects, where the enzyme cuts the wrong part of the genome, potentially killing the cell, Also sometimes the Homology-Directed Repair may not be efficient and may introduce mutations that can render the insert non functional

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

References

  1. Keyhole limpet haemocyanin – a model antigen for human immunotoxicological studies

  2. Construction of complex and diverse DNA sequences using DNA three-way junctions

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Week 3 HW: Lab Automation

cover image cover image

𓃠 Week 3 Homework 𓃠

Assignment: Python Script for Opentrons Artwork

Ancient Egyptian Pharaoh Oepntrons GUI Art Ancient Egyptian Pharaoh Oepntrons GUI Art

This is an Ancient Egyptian Pharaoh Figure, this was made using this GUI Also here is the live link to check it out! :D

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή
Note

This section is going to be just documentation about how i managed to draw the Ancient Egyptian Pharaoh Figure, to view the rest of the homework, You can skip to Post-Lab Questions

So i started out with this image which i generated using Gemini a long while ago.

Ancient Egyptian Pharaoh Ancient Egyptian Pharaoh
  • I wanted to draw it using the Opentrons OT-2 but i had no idea how + i am not a very good pixel artist.
  • So i decided to use AI to help me with this, first i went to Ronan’s GUI (Thanks Again Ronan! :D) and i roughly counted there was (on default settings) 36x36 pixels (i was off by a little number btw XD)
  • So i went back to Gemini and prompted it to draw my the image on a 36x36 pixel grid and this was the output
Ancient Egyptian Pharaoh Pixel Ancient Egyptian Pharaoh Pixel
  • It was pretty good to me, but i need coordinates for the Opentrons API, i tried to roughly copy it on Ronan’s GUI but i failed misreably and wasn’t accurate
  • So when i was searching online for tools to like give some sort of coordinates to this (and i didn’t find XD), i stumbled on this website called pixilart, I went in and generated a 36x36 pixel grid and guess what? I drew it from scratch using Gemini’s image as the reference and i added some tweaks myself to it too :D
Ancient Egyptian Pharaoh Pixel Redraw Ancient Egyptian Pharaoh Pixel Redraw
  • It took alot of effort trying to focus on those pixels to get a picture perfect copy of it, but in the end the mission was a success :D
  • Now that i could somehow get x/y coordinates, i wanted to redo this on Ronan’s GUI so that the coordinates i give to Opentrons are accurate, so now i had to take my new reference and map it there.
  • I tried to upload the image but it didn’t map it well at all, maybe because of the pixel grids, so i had to do it manually XD
Ancient Egyptian Pharaoh Pixel Redraw On Ronan’s GUI Ancient Egyptian Pharaoh Pixel Redraw On Ronan’s GUI
  • Here is a screenshot of me mapping every single pixel on Ronan’s GUI and marking it in red on pixilart so i don’t mix something up :D
  • It took sometime but the results were totally worth it :D
  • This way i took the generated coordinates and went the Opentrons Google Colab Notebook and used Gemini to write the actual function because i was too tired after all the drawing XD, and this was the result! :D
Ancient Egyptian Pharaoh Opentrons OT-2 Python API Ancient Egyptian Pharaoh Opentrons OT-2 Python API

Here is some other designs that i did too while in the Autonomous Cloud Lab Stream where we were printing Fluorescent Artwork designs

Ancient Egyptian Eye of Ra Nebula Ancient Egyptian Eye of Ra Nebula

This is the Eye of Ra, a very common and famous Ancient Egyptian Symbol

Ancient Egyptian Winged Scarab Nebula Ancient Egyptian Winged Scarab Nebula

This is a Winged Scarab, which is also a very well known Ancient Egyptian Symbol

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Post-Lab Questions β€” DUE BY START OF FEB 24 LECTURE

Find and describe a published paper that utilizes the Opentrons or an automation tool to achieve novel biological applications.

Paper: Development of a Modular Lab Automation System with Applications to Animal and Bacteria Cell Culture(1)

This paper is a perfect example of why automation is critical for modern synthetic biology. They identify the key challenges of manual lab work which includes that complex protocols are tedious, prone to human error, and suffers from a lack of reproducibility. and To solve this, so they developed a modular lab automation system. They validated their system through automating cell culture, for both simple bacteria (prokaryotic) and complex animal cells (eukaryotic).

The most important part of their project isn’t just the robot, it’s their focus on transparency, quality control, and community reuse. They created a system that automatically generates Jupyter Notebooks as a β€œfull protocol execution report,” which makes the experiments perfectly documented and reusable. They also described how this modular system is the first step toward β€œself-driving labs,” where AI and machine learning models can design and run their own experiments, possibly creating a fully automated DBTL cycle.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Write a description about what you intend to do with automation tools for your final project. You may include example pseudocode, Python scripts, 3D printed holders, a plan for how to use Ginkgo Nebula, and more.

Automation Tools can help me quickly and efficiently do many tasks and test different scenarios with minimal errors, for example in Idea 1 i can use Automation Tools to test out different circuits with different promotors to test them and check out which on is the most optimal and which ones burden the cell too much, same with Idea 2 where i can test different Inducer Ratios and measure production titers in a quick way

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Final Project Ideas

The presentation slides can be found at the Slides Deck

Idea 1: The Malaria Machine: Computational Optimization of Artemisinic Acid Biosynthesis

  • The Problem: Artemisinin, the frontline treatment for malaria which still kills ~600,000 people annually, relies on plant extraction from Artemisia annua β€” an inherently slow, geographically limited, and climate-vulnerable supply chain that cannot meet global demand consistently.

  • The Mechanism: This project computationally engineers a microbial factory (E. coli or yeast) to overproduce artemisinic acid, the direct biosynthetic precursor to artemisinin, by modeling the mevalonate pathway using flux balance analysis, systematically evaluating knockout and overexpression strategies, and designing optimized genetic circuits for the winning candidate.

  • The Impact: By delivering a fully documented, wet-lab-ready computational blueprint for high-yield artemisinic acid biosynthesis, this project contributes toward a scalable, plant-independent, and globally accessible supply of the world’s most critical antimalarial compound.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Idea 2: The Bio-Propulsion Model: Engineering Off-World Propellant

  • The Problem: High-density aerospace propellants (like JP-10) are entirely petroleum-derived, making them unsustainable on Earth and physically impossible to drill for during deep space missions.

  • The Mechanism: This project computationally optimizes a microbial factory, utilizing Metabolic pathway, to metabolically convert raw carbon into alpha-pinene.

  • The Impact: Because alpha-pinene can be chemically dimerized into a direct, high-energy biological equivalent of JP-10 rocket fuel, this creates a scalable, closed-loop propulsion supply for advanced aerospace applications.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Idea 3: The Coral Distress Beacon: Early-Warning Marine Biosensors

  • The Problem: Corals release specific chemical stress markers, such as Reactive Oxygen Species (ROS), immediately before undergoing heat-induced bleaching.

  • The Mechanism: This project proposes engineering a marine microbe biosensor with a targeted genetic logic circuit designed to detect these exact ROS molecules and output a highly visible fluorescent signal.

  • The Impact: By deploying this living “distress beacon,” marine biologists gain a realtime, colorful early warning system, allowing them to intervene and protect the reef before the ecological damage becomes irreversible.

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

References

  1. Development of a Modular Lab Automation System with Applications to Animal and Bacteria Cell Culture
π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Week 4 HW: Protein Design Part i

cover image cover image

𓃠 Week 4 Homework 𓃠

Part A. Conceptual Questions

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

References

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Week 5 HW: Protein Design Part ii

cover image cover image

𓃠 Week 5 Homework 𓃠

Part A (From Pranam)

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

References

π“‹Ή π“‹Ή π“‹Ή π“‹Ή π“‹Ή

Subsections of Labs

Week 1 Lab: Pipetting

cover image cover image

Subsections of Projects

Individual Final Project

cover image cover image

Group Final Project

cover image cover image