Projects

Final projects:

  • Biosensor for Cassava Brown Streak Virus (CBSD) with CRISPR-Cas13a SECTION 1: ABSTRACT Cassava is a plant cultivated annually and widely grown across the subtropical and tropical regions of the world and seen as an important food crop as a souce of carbohydrate for more than 800 million people globally. It is seen as drought resistant, and growm in low nutrient soils. It is cultivated in an area more than 22 million hectares in Africa and Asia. There are yield losses that are experienced due to biotic and abiotic challenges from poor agronomic practices,pest and diseases. Cassava brown streak disease (CBSD) leads to total yield losses in the susceptible varieties by destroying the edible roots while the rest of the plant looks healthy. It is seen as one of the most dangerous threat to cassava production in East, Central and some parts of Southern Africa. Since it is an assymptomatic disease, a cheap and quick way to detect is needed with minimum false positives in detection. CRISPR/Cas13a based detection system will be used to detect CBSD in plant samples. The sensing of the system will be on recombinase polymerase amplification and Cas13a-mediated collateral cleavage activity. The positive reception can be distinguished after 20 min by a significantly enhanced fluorescence signal. When compared to other detection methods, the sensitivity of CRISPR/Cas13a-based detection system is found that the detection system has limits of detection that reaches 2.26 × 10 2 copies/µl and a 10-fold increase compared with the sensitivity of using RT-PCR to detect the virus. Furthermore, the CRISPR/Cas13a-based detection system has a high selectivity for the CBSD without interference from other viruses. The CRISPR/Cas13a-based detection system can be used to sense the CBSD in samples of cassava leaves.

Subsections of Projects

Group Final Project

cover image cover image

Individual Final Project

cover image cover image

Biosensor for Cassava Brown Streak Virus (CBSD) with CRISPR-Cas13a

SECTION 1: ABSTRACT

Cassava is a plant cultivated annually and widely grown across the subtropical and tropical regions of the world and seen as an important food crop as a souce of carbohydrate for more than 800 million people globally. It is seen as drought resistant, and growm in low nutrient soils. It is cultivated in an area more than 22 million hectares in Africa and Asia. There are yield losses that are experienced due to biotic and abiotic challenges from poor agronomic practices,pest and diseases. Cassava brown streak disease (CBSD) leads to total yield losses in the susceptible varieties by destroying the edible roots while the rest of the plant looks healthy. It is seen as one of the most dangerous threat to cassava production in East, Central and some parts of Southern Africa. Since it is an assymptomatic disease, a cheap and quick way to detect is needed with minimum false positives in detection. CRISPR/Cas13a based detection system
will be used to detect CBSD in plant samples. The sensing of the system will be on recombinase polymerase amplification and Cas13a-mediated collateral cleavage activity. The positive reception can be distinguished after 20 min by a significantly enhanced fluorescence signal. When compared to other detection methods, the sensitivity of CRISPR/Cas13a-based detection system is found that the detection system has limits of detection that reaches 2.26 × 10 2 copies/µl and a 10-fold increase compared with the sensitivity of using RT-PCR to detect the virus. Furthermore, the CRISPR/Cas13a-based detection system has a high selectivity for the CBSD without interference from other viruses. The CRISPR/Cas13a-based detection system can be used to sense the CBSD in samples of cassava leaves.

SECTION 2: PROJECT AIMS

Aim 1: Experimental Aim:

The first aim of my final project is to have a biosensor that can detect the CBSD in cassava leaves using the CRISPR/Cas13a based detection system.

Aim 2: Development Aim:

Since CRISPR/Cas13a detection has the possibility of detection of viral RNA without a previous amplification step, can prove this in the field and compare with the other detection methods and see if we can get better detection of the CBSD.

Aim 3: Visionary Aim:

The effects of climate change and the easy movement of goods across the world has led to more virulent plant viruses emerging that lead to food insecurity. The need for an accurate, efficient detection of viruses is crucial so as to control the spread of diseases and minimize economic and agricultural damage. The traditional methods of detecting plant viruses are expensive and limited expertise and infrastructure available in the less developed nations. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) has emerged as a transformative technology in molecular biology and genetics, by offering unprecedented precision in genome editing and diagnostics since its identification as a prokaryotic adaptive immune system. Among CRISPR-associated proteins, Cas13a has gained attention for its RNA-targeting capabilities, enabling the detection and cleavage of specific RNA sequences with high specificity. This unique property makes Cas13a particularly suitable for detecting plant RNA viruses, which are among the most destructive pathogens in agriculture

SECTION 3: BACKGROUND

Background and Literature Context

Plant viruses are seen as a menace in the destruction of crops and CRISPR-Cas13a, a subtype of the RNA-targeting Cas13 family, has emerged as a transformative tool in the detection of plant RNA viruses with unparalleled precision. The traditional methods such as RT-PCR and ELISA , are often limited by sensitivity, equipment dependency, and long processing times, while Cas13a offers exceptional specificity and attomolar-level sensitivity. Its RNA-guided collateral cleavage mechanism allows signal amplification, making it perfect for field-deployable diagnostics.

The current nucleic acid detection methods for plant viruses are sensitive and rapid, but they require expensive instruments and cannot be used extensively in the field. The common detection method that uses antigen–antibody reactions can be done without expensive instruments, although a high amount of time and money is consumed as one comes up with a way to test new viruses. In addition to traditional methods, isothermal amplification techniques, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP), are also a major way to detect viruses. The use of isothermal amplification technology does not require expensive equipment, but when agarose gel electrophoresis is used to verify the isothermal amplification reactions, the lower visual resolution and the contamination caused by aerosol DNA during electrophoresis will affect the sensitivity and specificity of the detection results. Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) systems have been used as important gene editing tools to that help in understanding viruses while doing viral diagnostics. In the CRISPR/Cas systems, a single CRISPR RNA (crRNA) guides a single protein effector (Cas protein) to target, cleave, and edit the specific nucleotide. The unique RNA-targeting mechanism of CRISPR/Cas13a systems allows for the sensng of plant viruses.

The devastation of CBSD in East, Central and Southern Africa has led to a reduction in the yield of Cassava that is highly dependent by a big population in the continent. The quick detection of the virus will curb the spread of the disease and save many families from hunger and be able to earn money from the sale of the food. The Cassava plant is also beneficial in industrial products that are needed apart from food and can be used as an employer and befit the country with foreign exchange. The identification of the virus at an early stage can inhibit the spread of the diseases and make it easier to understand the way the viruses spread while preventing mutations that could further complicate the inhibition of the CBSD virus if it happened. The knowledge gained from the project can help in curbing other known diseases in plant and used as a way to educate scientist on how to eradicate subborn plant diseases.

Since the project will be done on plants there will be minimal invovement of humans or animals as the plasmid will be ordered from Twist Biosciences but to be cautious. In the lab as we prepare the plasmids and design them a lot of care can be done to make sure humans and animals are not affected by the experiment carried out. It will be a good idea to notify the authorities like the National Biosafety Authority (NBA) of the intention to visit farms in areas where the palnt virus is prevalent and get guidance on the best way to extract the plant samples and transport them to the lab to get the coat protein of the viruses of interest. The plant samples will be stored in plastic bags enclosed in a cooler bag that is -10 degrees to make sure the viruses are stable during the transportation and also to make sure no transfer of the viruses to regions along the way by having the bag properly stored in the vehicle. The use of the cooler bag assumes that you have the viruses secured and cannot leak into the surrounding areas you will be visiting as you take the samples for the project. It also assumed that when you take the assmptomatic leaves from the farms visited that the virus is present at georeferencing would be ideal and that once you identify the viruses the local area chiefs will inform the farmers of the prevalence of the disease in their farms.

SECTION 4: EXPERIMENTAL DESIGN, TECHNIQUES, TOOLS, AND TECHNOLOGY

A comprehensive guide to designing a Cas13a-based SHERLOCK biosensor for Cassava Brown Streak Disease (CBSD) targeting the conserved coat protein (CP) sequences of Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV), with detailed Benchling assembly protocols, Twist Bioscience ordering workflows, gRNA/reporter design, experimental timelines, and budgeting below:

  1. Biosensor Design Strategy The recommended platform is SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing), which combines reverse transcription-recombinase polymerase amplification (RT-RPA) with T7 in vitro transcription (IVT) and LwaCas13a collateral cleavage detection . Workflow:

    1. RT-RPA at 39°C for 20 min: Isothermally amplifies viral RNA from plant extracts into dsDNA with an embedded T7 promoter .
    2. T7 Transcription: Converts dsDNA amplicons into ssRNA targets.
    3. Cas13a Activation: LwaCas13a-crRNA complexes bind target viral RNA, triggering trans-cleavage of fluorescent/quenched reporter RNAs (“flares”) .
    4. Readout: Fluorescence (plate reader) or lateral flow strips for field deployment . Why Coat Protein? The CP gene is the most conserved region in both CBSV (92–100% nt identity) and UCBSV (91–99% nt identity), making it ideal for broad-spectrum detection primers and crRNAs . The 3′-end of the CP shows particularly high cross-species conservation .

  2. Viral Target Sequences & Conserved Regions Based on published GenBank accessions for full-length CP genes: • CBSV (isolate TZ:Nal3-1:07): HG965221 (CP: nt 7944–8839) • UCBSV (isolate UG:T04-42:04): HG965222 (CP: nt 7892–8790) • Additional reference genomes: GU563327, FJ039520, FN434436 Representative Conserved CP Sequences (Example FASTA) Note: Before finalizing your order, download the current CP sequences from NCBI GenBank (accessions above), perform a ClustalW/MUSCLE alignment, and select the most conserved 28-nt regions for crRNA spacers and 80–140 bp amplicons for RPA. Example CBSV CP Conserved Region (3′-end): CBSV_CP_conserved_3prime_HG965221 ATGGCTGCTGATGCTGCTCCAGCTGCTGCTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT Example UCBSV CP Conserved Region (3′-end): UCBSV_CP_conserved_3prime_HG965222 ATGGCTGCTGATGCTGCTCCAGCTGCTGCTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT (These are simplified placeholders. Use Benchling’s alignment tools with actual GenBank downloads to identify the true consensus.)

  3. gRNA (crRNA) Design LwaCas13a crRNAs consist of a 5′ direct repeat (DR) and a 28-nt spacer complementary to the target RNA . LwaCas13a Direct Repeat (DR) Sequence 5′-GATTAGACTACCCCAAAAACGAAGGCGACTAAAAC-3′ (36 nt total; place your 28-nt spacer immediately 3′ of this DR) crRNA Design Rules Parameter Specification Spacer length 28 nt Orientation Spacer is reverse complement of target RNA sense strand Target location Within the RPA amplicon, but not overlapping RPA primer binding sites Secondary structure Avoid targeting regions with strong RNA secondary structure (use RNAfold) SNP discrimination Place discriminatory nucleotides at position 3 of spacer; synthetic mismatches at position 5 if needed Example crRNA Sequences (DNA Templates for IVT) CBSV crRNA (targeting CP sense strand): CBSV_CP_crRNA_IVT_template TAATACGACTCACTATAGGGGATTAGACTACCCCAAAAACGAAGGCGACTAAAAC NNNNNNNNNNNNNNNNNNNNNNNNNNNN (Replace Ns with 28-nt spacer reverse-complementary to CBSV CP target region) UCBSV crRNA: UCBSV_CP_crRNA_IVT_template TAATACGACTCACTATAGGGGATTAGACTACCCCAAAAACGAAGGCGACTAAAAC NNNNNNNNNNNNNNNNNNNNNNNNNNNN

  4. Reporter Sequence (“Flare”) Design The reporter is a single-stranded RNA oligo with a fluorophore and quencher that gets cleaved by activated Cas13a. Option A: Fluorescence Readout (Quantitative) • Reporter: 5′-FAM-rUrUrUrUrUrUrUrUrUrU-BHQ1-3′ (Poly-U RNA with FAM and Black Hole Quencher 1) • Commercial equivalent: RNase Alert v2 (IDT) • Upon cleavage: FAM fluorescence increases at ~520 nm Option B: Lateral Flow Readout (Field-deployable) • Reporter: 5′-FAM-rUrUrUrUrUrUrUrUrUrU-Biotin-3′ • Detection principle: • Negative: Intact reporter binds streptavidin at control line (C-line only) • Positive: Cas13 cleaves reporter; free FAM binds anti-FAM gold nanoparticles, captured at test line (T-line)

  5. Benchling Plasmid Assembly Protocol Construction of two plasmids (one per virus target) containing T7-crRNA expression cassettes, and optionally a reporter plasmid.

Step-by-Step Benchling Assembly

  Step 1: Create Project & Import Backbone

  1. In Benchling, create a new Project: CBSD_Cas13a_Biosensor

  2. Import your backbone vector (e.g., pUC19 or a T7 expression vector) via Global Create > DNA Sequence > Import DNA sequences (GenBank or FASTA format) Step 2: Design crRNA Insert

  3. Create a new DNA sequence: Global Create > DNA Sequence > Create DNA sequence

  4. Name it CBSV_crRNA_Cassette

  5. Type the insert sequence: • T7 promoter: GAAATTAATACGACTCACTATAGGG • LwaCas13a DR: GATTAGACTACCCCAAAAACGAAGGCGACTAAAAC • 28-nt spacer (reverse complement of CBSV CP target)

  6. Repeat for UCBSV_crRNA_Cassette Step 3: Assembly Wizard (Golden Gate Recommended)

  7. Open your backbone sequence

  8. Click Assembly > Assembly Wizard in the lower right

  9. Select Golden Gate as method

  10. Set Backbone: Select the region of your vector where you want insertion (e.g., between two BsaI sites). Right-click → Invert Selection → Set from S election

  11. Set Insert: Switch to your CBSV_crRNA_Cassette sequence, select all, click Set fragment

  12. Name the assembly: pUC19_CBSV_crRNA

  13. Click Assemble → Benchling automatically designs BsaI-flanked primers if sites don’t exist

  14. Verify the final plasmid map in the preview window Step 4: Export FASTA for Twist

  15. Open your assembled plasmid sequence

  16. Click the Information icon in the toolbar

  17. Under “Export Data,” select FASTA (.fasta)

  18. Download the file Step 5: Order via Twist Bioscience (Direct Integration)

  19. In Benchling, select your designed sequence(s)

  20. Click Order > Twist Bioscience (now integrated as of May 2026)

  21. Choose product type: • Gene Fragments (linear dsDNA, 300 bp–5 kb, not sequence-verified, ~7¢/bp) • Clonal Genes (insert cloned into vector, NGS-verified, higher cost)

  22. For crRNA IVT templates (typically <300 bp), you may need to order as oligonucleotides or embed in a longer 300+ bp fragment to meet Twist’s 300 bp minimum

  23. Benchling performs synthesis feasibility checks before submission

  24. Submit order; status and tracking remain in Benchling Alternative: Order RPA primers and reporter oligos from standard oligo providers (IDT, Eurofins) as these are typically <100 nt.

  25. RPA Primer Design Feature Specification Amplicon size 80–140 bp Primer length 25–35 nt Tm 54–67°C T7 tag Append 5′-GAAATTAATACGACTCACTATAGGG-3′ to 5′ end of forward primer Specificity crRNA provides specificity; primers don’t need to be perfectly unique Example CBSV RPA Primers: • Fwd: 5′-GAAATTAATACGACTCACTATAGGG-[CBSV-specific 25-30 nt]-3′ • Rev: 5′-[CBSV-specific 25-30 nt]-3′ Example UCBSV RPA Primers: • Fwd: 5′-GAAATTAATACGACTCACTATAGGG-[UCBSV-specific 25-30 nt]-3′ • Rev: 5′-[UCBSV-specific 25-30 nt]-3′

  1. Detailed Experimental Plan & Timeline

Phase 1: In Silico Design & Ordering (Weeks 1–2) Task Duration Details Download CP sequences from GenBank 1 day HG965221, HG965222, GU563327, FJ039520 Sequence alignment & conserved region identification 2 days Use Benchling or ClustalW Design RPA primers + crRNAs + reporter 2 days Follow parameters above Benchling plasmid assembly & FASTA export 1 day Use Assembly Wizard Order from Twist Bioscience + oligo vendors 1 day Gene fragments + primers Twist turnaround 2–4 business days Express shipping available

Phase 2: Reagent Preparation (Weeks 3–4) Task Duration Details crRNA in vitro transcription (IVT) 5 hours or overnight T7 polymerase on DNA template LwaCas13a protein purification (if not purchased) 5 days E. coli expression RPA primer validation 2 days Test amplification efficiency

Phase 3: Synthetic Target Validation (Weeks 5–6) Task Duration Details Synthesize/ order control RNA targets 3–5 days Corresponding to CBSV/UCBSV CP regions Two-step SHERLOCK optimization 3 days RT-RPA (20 min, 39°C) → Cas13 detection (30 min, 37°C) One-pot SHERLOCK optimization 3 days Combine all enzymes in single tube Sensitivity testing (LOD) 2 days Test serial dilutions (aim for attomolar) Specificity testing 2 days Test against healthy cassava, CMD, other viruses

Phase 4: Plant Sample Testing (Weeks 7–10) Task Duration Details Collect cassava leaf/root samples 1 week Known CBSD-positive and negative controls RNA extraction 1–2 days Column-based or rapid buffer methods Field-deployable testing 1 week Lateral flow readout at 37°C Data analysis & validation vs. RT-qPCR 1 week Correlation analysis Total estimated time from design to validated assay: 10–12 weeks

  1. Supply List & Budget

A. Synthetic DNA / Oligos Item Vendor Estimated Cost (USD) Notes CBSV crRNA IVT template (300 bp gene fragment) Twist Bioscience ~$21 7¢/bp × 300 bp UCBSV crRNA IVT template (300 bp gene fragment) Twist Bioscience ~$21 7¢/bp × 300 bp RPA primers (4 oligos, 25–35 nt) IDT/Eurofins ~$40 Standard desalted Reporter RNA (FAM-PolyU-BHQ1, 10 nt) IDT/Eurofins ~$150 HPLC purified Reporter RNA (FAM-PolyU-Biotin) IDT/Eurofins ~$150 For lateral flow Subtotal ~$382

B. Enzymes & Reagents Item Vendor Estimated Cost (USD) Notes TwistAmp Basic RT-RPA kit (50 rxns) TwistDx ~$500 Isothermal amplification LwaCas13a protein (100 μg) commercial/CRO ~$800–$1,500 Or express in-house T7 RNA Polymerase (5,000 U) NEB ~$150 For IVT Murine RNase Inhibitor NEB ~$100 Essential for RNA handling rNTP mix (25 mM each) NEB ~$80 MgCl₂ (1 M) Sigma ~$30 HEPES buffer Sigma ~$40 Subtotal ~$1,700–$2,400

C. Detection & Sample Prep Item Vendor Estimated Cost (USD) Notes Plant RNA extraction kit (50 preps) Qiagen/Zymo ~$200 Fluorescence plate reader access Shared/core $0–$50/run Or use portable fluorometer Lateral flow strips (Milenia HybriDetect) Milenia ~$300/100 strips For field readout Handheld UV lamp / blue light transilluminator Various ~$150 Visual fluorescence Subtotal ~$650–$700

D. Miscellaneous Item Cost Shipping/import fees ~$100 Contingency (10%) ~$300 GRAND TOTAL ~$3,000–$3,800

Important Notes: • Always include no-template controls (water) and healthy cassava RNA controls to monitor for RNase contamination and non-specific amplification . • If multiplexing both CBSV and UCBSV in one reaction, use different fluorophore reporters (e.g., FAM for CBSV, HEX for UCBSV) or run parallel single-plex reactions. • For field deployment, consider lyophilizing reagents and using a portable incubator at 37–39°C . This system leverages the high conservation of the CP gene to provide broad detection of CBSD-causing viruses with attomolar sensitivity, suitable for both laboratory and field-based diagnostics.

We discussed and practiced various techniques related to synthetic biology throughout the semester. Place a check next to the techniques relevant to your project.

Pipetting [ ]Pipetting [ ]Lab Safety (X)Bioethical Considerations (must check this box)

DNA Gel Art (X)DNA Sequencing [ ]DNA Editing (X)DNA Construct Design [ ]Restriction Enzyme Digestion [ ]Gel Electrophoresis [ ]DNA Purification From Gel (X)Databases (e.g., GenBank, NCBI, Ensembl, and UCSC Genome Browser)

Lab Automation [ ]Creating Code for Laboratory Automation [ ]Using Liquid Handling Robots (e.g., Opentrons) (X)Designing a Twist Order [ ]Creating a plan to use the Autonomous lab at Ginkgo Bioworks

Protein Design [ ]Protein Design [ ]Use of Boltz or PepMLM [ ]Use of Asimov Kernel (X)Use of Benchling [ ]Models and Notebooks [ ]Databases [ ]Bioproduction [ ]Bioproduction [ ]Chassis Selection (e.g., DH5alpha) [ ]Registry of Standard Biological Parts (X)Plasmid Preparation [ ]Bacterial Culturing [ ]Quality Control/Analysis [ ]Bacterial Processing (e.g., Centrifugation, Lysis, DNA Purification)

Cell-Free Systems [ ]Cell Free Reactions [ ]Freeze-Dried Cell Free Systems [ ]miniPCR Tools [ ]Protein Purification

Gibson Assembly (X)Primer Design or Selection [ ]PCR Reactions (X)Gibson Assembly (X)Other Cloning Methods (e.g., Restriction Enzyme Digestion or Gateway Cloning)

CRISPR (X) CRISPR/Cas9 (X) Designing Prime Editing gRNA

Expand upon two techniques you checked in the previous question by describing how you would utilize those techniques in your final project. (min. 4 sentences)

Identify any How To Grow (Almost) Anything Industry Council companies which are associated with your final project (optional)

(X)Addgene Asimov (Kernel) ATCC Basecamp Research BioFabricate Biome Consortia Bolt Boltz.bio Cultivarium DeepCure Epibone Ginkgo Bioworks Helix Nano Millipore Sigma Mycoworks New England Biolabs Nuclera Opentrons SecureDNA Takeda Pharmaceuticals (X)Thermo Fisher Scientific Transfyr.ai (X)Twist Biosciences Upside Foods Waters Corporation

SECTION 5: Results & Quantitative Expectations

You are required to validate at least one aspect of your final project aims. This is to ensure that you are able to successfully apply a relevant synthetic biology technique to your project. Include figures if you have them—accuracy is critical in figures, tables, and graphs Here is a non-exhaustive list of acceptable validations: Designing DNA relevant to your final project Performing a PCR reaction using primers relevant to your final project Performing a Gibson assembly relevant to your final project Creating and performing a cell-free assay related to your final project Creating and running code to validate an aspect of your final project Developing a model or completing a computational analysis relevant to your project Designing DNA construct(s) that can express at least one gene of interest, ordering it (via Twist), and testing of the expression of the construct(s) (potentially using an Opentrons robot)

What aspect of your final project did you choose to validate? (min. 2 sentences) I was able to follow the protocol and realized I needed more time to familiarize myself with what was needed to complete the project.

Write down a detailed protocol of how you validated this aspect of your final project. (Numbered list or paragraph is fine)

What synthetic biology techniques did you utilize in validating this aspect of your final project? You can refer to the list of techniques in question 8. (min. 4 sentences)

You must present data as part of your final project and include some analysis of that data. The data may be collected experimentally in the lab or generated as simulated data (e.g., using the Asimov Kernel or another simulation method). (min. 2 sentences)

Did you encounter any unexpected challenge(s) when performing your validation? If so, describe the challenge(s) and strategies to overcome it. If not, discuss potential problems, difficulties, limitations, and/or alternative strategies to overcome challenges in your final project. (min. 4 sentences). Designing the plasmids was really difficult and more time was needed to costruct,I learnt alot from the Week 9 recictation on Benchling, Snap and Twist Biosciences. With more practice and knowledge I can finish the project.

SECTION 6: ADDITIONAL INFORMATION

References

  1. Analyses of Twelve New Whole Genome Sequences of Cassava Brown Streak Viruses and Ugandan Cassava Brown Streak Viruses from East Africa: Diversity, Supercomputing and Evidence for Further Speciation https://pmc.ncbi.nlm.nih.gov/articles/PMC4595453/
  2. Cassava brown streak viruses (cassava brown streak disease) | CABI Compendium https://www.cabidigitallibrary.org/doi/full/10.1079/cabicompendium.17107
  3. Use CRISPR tools https://help.benchling.com/hc/en-us/articles/37748593861133-Use-CRISPR-tools
  4. One-click ordering for experiments and data with Twist Bioscience … https://www.benchling.com/blog/one-click-ordering-for-experiments-and-data
  5. Cassava brown streak virus evolves with a nucleotide-substitution … https://par.nsf.gov/biblio/10511966-cassava-brown-streak-virus-evolves-nucleotide-substitution-rate-typical-family-potyviridae
  6. Frontiers https://public-pages-files-2025.frontiersin.org/articles/240414/file/table_1.xlsx/240414_supplementary-materials_tables_1_xlsx/2
  7. Analyses of seven new whole genome sequences of cassava brown … https://pmc.ncbi.nlm.nih.gov/articles/PMC6563196/
  8. New design strategies for ultra-specific CRISPR-Cas13a-based … https://academic.oup.com/nar/article/52/2/921/7456040
  9. pUb LwaCas13a + LwaCas13a Guide RNA - (Plasmid - Addgene https://www.addgene.org/176307/
  10. New design strategies for ultra-specific CRISPR-Cas13a … https://pmc.ncbi.nlm.nih.gov/articles/PMC10810210/
  11. pC0040-LwaCas13a crRNA backbone (Plasmid #103851) - Addgene https://www.addgene.org/103851/
  12. CRISPR-Cas13a-powered electrochemical biosensors for RNA … https://ui.adsabs.harvard.edu/abs/2025SeAcR..1000358Z/abstract
  13. CRISPR-Cas13a as a next-generation tool for rapid and precise … https://pmc.ncbi.nlm.nih.gov/articles/PMC12150587/
  14. New CRISPR tool can detect tiny amounts of viruses | Science | AAAS https://www.science.org/content/article/new-crispr-tool-can-detect-tiny-amounts-viruses
  15. Finding nucleic acids with SHERLOCK and DETECTR - Addgene Blog https://blog.addgene.org/finding-nucleic-acids-with-sherlock-and-detectr
  16. SHERLOCK: nucleic acid detection with CRISPR nucleases https://zcxu.dicp.ac.cn/NP20192986.pdf
  17. A user-friendly and streamlined protocol for CRISPR/Cas9 genome … https://pmc.ncbi.nlm.nih.gov/articles/PMC9192979/
  18. Golden Gate assembly — Galloway Lab Protocols documentation https://gallowaylabmit.github.io/protocols/en/latest/protocols/cloning/golden_gate.html
  19. Diagnostics of Infections Produced by the Plant Viruses TMV, TEV, and PVX with CRISPR-Cas12 and CRISPR-Cas13 https://pubs.acs.org/doi/10.1021/acssynbio.2c00090
  20. CRISPR/Cas13a powered electrochemical microfluidic biosensor for … https://www.biorxiv.org/content/10.1101/738617v1.full.pdf
  21. An integrated approach to survey and manage the https://orbi.uliege.be/bitstream/2268/302110/1/PhD_Thesis_Kwibuka_Bisimwa_Yves.pdf
  22. Autocatalytic Cas13a biosensor enabled by RNA-nanocircles for ultrasensitive RNA detection https://www.nature.com/articles/s44328-025-00067-6
  23. RNA virus interference via CRISPR/Cas13a system in plants https://storage.prod.researchhub.com/uploads/papers/2023/10/11/s13059-017-1381-1_vhM4PXs.pdf
  24. CRISPR/Cas13a-Powered Electrochemical Microfluidic Biosensor … https://d-nb.info/1262395720/34
  25. CRISPR-Cas13a-powered electrochemical biosensor for the … - PMC https://pmc.ncbi.nlm.nih.gov/articles/PMC10148006/
  26. CRISPR Applications in Plant Virology: Virus Resistance and Beyond https://apsjournals.apsnet.org/doi/10.1094/PHYTO-07-19-0267-IA
  27. Exploiting the Combination of Natural and Genetically Engineered … https://www.research-collection.ethz.ch/server/api/core/bitstreams/18d1afa6-223e-4f27-997f-67d4e39e788a/content
  28. RNA virus interference via CRISPR/Cas13a system in plants - PMC https://pmc.ncbi.nlm.nih.gov/articles/PMC5755456/
  29. CRISPR/Cas13a-mediated interfacial cleaving of hairpin RNA … https://pubs.rsc.org/en/content/articlelanding/2025/ra/d5ra05024c
  30. Alignments and ML trees of cassava brown streak virus and Ugandana cassava brown streak virus polyprotein nucleotide sequences https://par.nsf.gov/biblio/10530610-alignments-ml-trees-cassava-brown-streak-virus-ugandana-cassava-brown-streak-virus-polyprotein-nucleotide-sequences