Week 6 HW: Genetic Circuits Part I: Assembly Technologies

🧪 Part A: DNA Assembly

1. Components of Phusion High-Fidelity PCR Master Mix and Their Purpose

The Phusion High-Fidelity PCR Master Mix is optimized for accurate DNA amplification and typically contains:

Phusion DNA Polymerase

A high-fidelity DNA polymerase enzyme.
Synthesizes new DNA strands during PCR. Has proofreading activity (3’ → 5’ exonuclease) which corrects mismatched bases, reducing mutation rates.

dNTPs (Deoxynucleotide Triphosphates)

Building blocks of DNA: dATP, dTTP, dCTP, dGTP
Polymerase incorporates these nucleotides into the growing DNA strand.

Reaction Buffer (HF Buffer)

Contains several important chemicals: Mg²⁺ ions
Required cofactor for DNA polymerase activity.
Salt and pH stabilizers
Maintain optimal conditions for enzyme activity.

Stabilizers

Help preserve enzyme structure during thermal cycling.

Optional additives

May include compounds improving amplification of GC-rich sequences.

To provide a ready-to-use mixture that supports accurate, efficient DNA amplification during PCR.

2. Factors That Determine Primer Annealing Temperature

The annealing temperature (Ta) during PCR determines how well primers bind to the DNA template. Key factors include:

Primer Melting Temperature (Tm)

The most important factor. Annealing temperature is usually 2–5°C below the lowest primer Tm.

GC Content

GC pairs have 3 hydrogen bonds (stronger).
Higher GC content increases primer stability and raises Tm.

Primer Length

Longer primers bind more strongly.
Typical length: 18–22 bp.

Salt Concentration

Higher salt stabilizes DNA duplexes and increases Tm.

Secondary Structures

Hairpins or primer dimers can reduce effective binding.

Template complexity

Highly repetitive DNA may require different annealing conditions

3. PCR vs Restriction Enzyme Digests for Creating Linear DNA

Feature	PCR	Restriction Digest
Mechanism	DNA amplification using primers and polymerase	DNA cutting using sequence-specific enzymes
Protocol	Thermal cycling (denature → anneal → extend)	Incubation with restriction enzyme at constant temperature
DNA Required	Very small template amounts	Requires sufficient plasmid DNA
Flexibility	Can introduce mutations or new sequences	Limited to enzyme recognition sites
Speed	~1–2 hours	~30–60 minutes digestion
Precision	Depends on primer design	Cuts exactly at recognition sequence

When PCR is preferable

Introducing mutations
Creating new overlaps
Amplifying small fragments

When restriction digest is preferable

Cloning using existing restriction sites
Cutting large plasmids
Avoiding PCR errors

4. Ensuring DNA Fragments Are Compatible for Gibson Assembly

To ensure successful Gibson cloning, fragments must have:

Overlapping sequences

Typically 20–40 bp identical overlap between fragments.

Correct orientation

Fragments must be designed so overlaps match the correct 5’ → 3’ direction.

Clean DNA fragments

Remove template plasmid using DpnI digestion.
Purify PCR products using DNA cleanup columns.

Correct fragment sizes

Verify using agarose gel electrophoresis.

Accurate concentration

Measure with Nanodrop or Qubit to achieve correct molar ratios.

5. How Plasmid DNA Enters E. coli During Transformation

Step-by-step mechanism

Competent cells

E. coli cells are chemically treated (CaCl₂).
This neutralizes negative charges on DNA and membrane.

DNA incubation on ice

DNA binds loosely to the cell membrane.

Heat shock (42°C)

Creates temporary pores in the membrane.

DNA entry

Plasmid DNA diffuses into the cytoplasm.

Recovery

Cells recover in SOC media and begin expressing antibiotic resistance genes.

Selection

Cells with plasmids survive on antibiotic plates.

6. Another DNA Assembly Method: Golden Gate Assembly

Golden Gate Assembly is a molecular cloning technique that allows the simultaneous assembly of multiple DNA fragments in a single reaction. It uses Type IIS restriction enzymes (such as BsaI or BsmBI) that cut DNA outside their recognition sequence, generating custom overhangs. These overhangs are designed so fragments assemble in a specific order. During the reaction, the enzyme repeatedly digests DNA fragments and ligase re-joins them, gradually producing the desired construct. Because the restriction sites are removed after assembly, the final plasmid is scarless, meaning no extra sequences remain. Golden Gate is highly efficient and commonly used in synthetic biology, metabolic engineering, and modular cloning systems like MoClo. It is especially useful when assembling many DNA fragments simultaneously.

7. Modeling Golden Gate Assembly Using Benchling

Attempt 1

Initally I decided to directly build a complicated genetic circuit design for my final project idea (lunglite) using golden gate assembly method but failed:

Steps involved:

I created a benchling project-

Created folders in same project-

Plasmid Backbone
Gene Modules
Golden Gate Fragments
Assembly Simulation
Final Constructs

Imported plasmid sequence to the folder “Plasmid Backbone”-

Plasmid sequence visualized as follows:

Highlight TGTCAG as Chromophore Site In amilCP gene:

I directly searched for the sequence:

Creating annotation of the identified sequence:

Didn’t highlight the region properly had to do the step again:

Selected golden gate assembly

Attempt 2

After several failed attempts, the following steps attached show a successful implementation for Golden Gate Assembly modeling:

Backbone DNA Sequence: pUC19

Insert sequence (GFP Protein):

GFP_insert
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG