Week 1 HW: Principles and Practices
This page tackles each of the week 1 Class Assignment Questions and the few Homework Assignment Questions from Professors.
Week 2 HW: DNA Read, Write, & Edit
This page tackles each of the week 2’s HomeWork Questions.
This page tackles each of the week 1 Class Assignment Questions and the few Homework Assignment Questions from Professors.
| Question 1 | First, describe a biological engineering application or tool you want to develop and why. This could be inspired by an idea for your HTGAA class project and/or something for which you are already doing in your research, or something you are just curious about. |
| Answer 1 | All living cells perform cell division; however, every cell division causes telomere shortening (Telomeres are protective caps at the ends of chromosomes). The limit of the number of cell divisions till a safe limit, such that no useful information is lost (directly from the DNA; telomeres still get shortened in the process), is known as the Hayflick Limit (discovered by Leonard Hayflick in the 1960s). The process of telomere shortening/attrition is one of the (currently 13) Hallmarks of Ageing; therefore, understanding how to increase this limit will be a game-changer. Scientists & Researchers have been trying to do this using different techniques; the purpose of this HTGAA Individual Project is to suggest a few novel methods and try to understand how implementing them fares wrt. to other methods, as well as understand the bio-technical nuances/problems which might occur due to these changes in the DNA, subsequently, during cell division stages… The methods to be explored include:
|
| Question 2 | Next, describe one or more governance/policy goals related to ensuring that this application or tool contributes to an “ethical” future, like ensuring non-malfeasance (preventing harm). Break big goals down into two or more specific sub-goals. Below is one example framework (developed in the context of synthetic genomics) you can choose to use or adapt, or you can develop your own. The example was developed to consider policy goals of ensuring safety and security, alongside other goals, like promoting constructive uses, but you could propose other goals for example, those relating to equity or autonomy. |
| Answer 2 | To ensure the technology does not cause disruption in the evolutionary process of species, biosystems, etc. or allow the development of bioweapons, a few governance or policy goals are suggested.
|
| Question 3 | Next, describe at least three different potential governance “actions” by considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & “Success”). Try to outline a mix of actions (e.g. a new requirement/rule, incentive, or technical strategy) pursued by different “actors” (e.g. academic researchers, companies, federal regulators, law enforcement, etc). Draw upon your existing knowledge and a little additional digging, and feel free to use analogies to other domains (e.g. 3D printing, drones, financial systems, etc.). • Purpose: What is done now and what changes are you proposing? • Design: What is needed to make it “work”? (including the actor(s) involved - who must opt-in, fund, approve, or implement, etc) • Assumptions: What could you have wrong (incorrect assumptions, uncertainties)? • Risks of Failure & “Success”: How might this fail, including any unintended consequences of the “success” of your proposed actions? |
| Answer 3 |
|
| Question 4 | Next, score (from 1–3, with 1 as best, or n/a) each of your governance actions against your rubric of policy goals: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| Answer 4 |
|
| Question 5 | Last, drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why. Outline any trade-offs you considered as well as assumptions and uncertainties. For this, you can choose one or more relevant audiences for your recommendation, which could range from the very local (e.g. to MIT leadership or Cambridge Mayoral Office) to the national (e.g. to President Trump or the head of a Federal Agency) to the international (e.g. to the United Nations Office of the Secretary-General, or the leadership of a multinational firm or industry consortia). These could also be one of the “actor” groups in your matrix. |
| Answer 5 | Many of the governance opinions suggested hereinabove are already practised in some or the other form (in varying intensities)[7] to prevent biowarfare. However, with the advent of powerful AI infrastructure allowing real-time decision-making, integration of the proposed Knowledge Tree with a continuous data stream from detection units is a promising future (although enhancing cybersecurity risks), allowing immediate detection of environmental contamination at a wider level than previously possible. Furthermore, an international decentralised governing framework of the technology development direction by the scientific community itself is suggested to prevent misuse and/or proliferation. In this regard, a combination of the Technology-Knowledge Graph of participating members, the establishment of a decentralised Oversight Body, and the leveraging of state-of-the-art biologics detection systems, along with real-time data analysis for immediate threat perception through autonomous (AI-enabled, with human in the loop) decision-making, is key towards the development of a tight-knit, trustworthy and unbiased ecosystem. |
| Question 6 | Reflecting on what you learned and did in class this week, outline any ethical concerns that arose, especially any that were new to you. Then propose any governance actions you think might be appropriate to address those issues. This should be included on your class page for this week. |
| Answer 6 | Philosophically speaking, the class focused on why D/Acc [8] (i.e. cautiously moving towards technological progress, ensuring existing or in-research technologies cannot cause near-doomsday events or something even close) is more important than E/Acc[9] (a techno-optimistic utopian idea of allowing unrestricted technological progress). For my individual project idea, the ultimate goal is to test the suggested methods on embryos of smaller organisms (such as worms, flies, and mice). The final implementation in larger organisms and humans needs to be handled extremely carefully. Governance mechanisms must ensure that this does not cascade to humans until the holistic, deep after-effects of such methods are well understood; these mechanisms should intend to extend our current understanding of ripple/butterfly effects across massive timescales, e.g. how much of the chromatic/DNA/genetic edits are actually inherited (if at all) and what could be the evolutionary impact of the same. |
| Questions | Answers |
|---|---|
| ~from Professor Jacobson: | |
| 1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome? How does biology deal with that discrepancy? | DNA polymerase has a raw error rate of approximately 10-4-10-5 errors per nucleotide added; this can cause high errors when compared to the ~3 × 109 base pairs of the human genome, as this can introduce thousands of mutations per cell division. This discrepancy is tackled through multiple layers of error control, including polymerase proofreading, post-replication mismatch repair, and cell-cycle checkpoints or apoptosis that eliminate heavily damaged cells, reducing the effective mutation rate to ~10-9–10-10 per base per division. |
| 2. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest? | An average human protein is ~300 amino acids, and each amino acid is encoded by 1–6 synonymous codons (let's take an average of ~3 codons per amino acid). This makes the number of possible DNA sequences encoding the same protein roughly ≈ 3300 ≈ 10143 possible nucleotide sequences. In practice, synonymous codons can affect translation dynamics and mRNA stability; rare codons affect translation speed & tRNA bias, slowing ribosomes (waiting for low-abundance tRNAs). |
| ~from Dr. LeProust: | |
| 1. What’s the most commonly used method for oligo synthesis currently? | Phosphoramidite solid-phase synthesis seems the most commonly used method for oligonucleotide (oligo) synthesis currently, as it is an automated chemical process that builds oligonucleotides nucleotide-by-nucleotide on a solid support. |
| 2. Why is it difficult to make oligos longer than 200nt via direct synthesis? | Direct chemical synthesis of oligonucleotides longer than 200nt is extremely difficult due to cumulative errors; even a 1% failure per step eliminates >90% of the desired product by 200nt due to error accumulation. |
| 3. Why can’t you make a 2000bp gene via direct oligo synthesis? | - Per step error increases exponentially over thousands of cycles, making such a long synthesis impossible - Longer chains on solid supports block reagent diffusion, dropping coupling efficiency - Additionally, extremely large quantities of chemicals will be required for the steps (which are performed in batches) |
| ~from George Church: | |
| 1. What are the 10 essential amino acids in all animals, and how does this affect your view of the “Lysine Contingency”? | 10 essential amino acids required by most animals are: - Histidine - Isoleucine - Leucine - Lysine - Methionine - Phenylalanine - Threonine - Tryptophan - Valine - Arginine The "Lysine Contingency" from Jurassic Park (1993) was related to genetically engineered dinosaurs unable to synthesise lysine, making them dependent on other lysine sources (thereby making them dependent on humans to feed them Lysine). This is actually not possible as Lysine is already available in meat/fish/grains, etc and even in many single-celled organisms. Thus the dinosaurs could actually still get Lysine from their prey; herbivorous dinosaurs can also obtain Lysine through microbial gut fermentation (through micro-organisms within their guts; it would be impossible for no microbiota to exists as then the digestive system would collapse; it would be another interesting project to understand the consequences of removing all microbiota from a healthy gut of a mouse and seeing the consequences, both computationally via metabolic pathway analysis as well as experimentally). |
This page tackles each of the week 2’s HomeWork Questions.
To understand the basics of Gel Electrophoresis (Gl. Ep.), I watched the following videos:
My understanding of Gl. Ep. is that it simply pulls DNA through a maze, which has channels and pores; each DNA fragment experiences the same force per unit length (so essentially the intended forward acceleration for all DNA fragments would have been the same if there was no friction), but the maze structure creates more resistance/friction to the longer fragments due to which they slow down. Thus we get different bands; unless the pore formation is deterministic and can be atomistically replicated, this is essentially a heuristic which works in real life (as pores in different lanes can also be different; I think there should be a metric to measure if the lanes should have the same weight; this can be achieved by puting the test DNA in the lanes, but also placing a much longer and a much shorter DNA-fragment in all the lane-wells; ideally there should be a straight line formed at the top and bottom (imagine the first and last step of the ladder stretched out across all lanes) and the metric should be how straight the line is! Straighter the line the more holistically equal all the DNA-racing lanes are!).
The answer to the question on this website (under “2. DNA Gel Ladders”) “Because DNA has the same charge per mass for any number of nucleotides, gel electrophoresis separates DNA purely based on length (can you think why?)” is:
~ because the force per unit mass is same, and the only differentiating factor becomes the DNA-travel/movement resistance due to the gel which is proportional to the length (more the length there are more contact points with the gel and longer DNA cant pass through those pores easily, essentially creating a length-specific bottleneck…
(Due to lack of time and the problem being a fathomable combinatorial problem, I chose to use my imagination and get the best of whatever sequence was generated; in case any1 is interested in getting hold of a mathematical formulation which can directly output the enzymes required for each lane of a specific design pattern, I can develop such an MILP formulation…)
I have chosen the TRF2 (Telomeric Repeat-binding Factor 2); this protein seems to be a good choice given my individual project idea as this protein:
The Amino Acid sequence is:
MAAGAGTAGPASGPGVVRDPAASQPRKRPGREGGEGARRSDTMAGGGGSSDGSGRAAGRRASRSSGRARRGRHEPGLGGPAERGAGEARLEEAVNRWVLKFYFHEALRAFRGSRYGDFRQIRDIMQALLVRPLGKEHTVSRLLRVMQCLSRIEEGENLDCSFDMEAELTPLESAINVLEMIKTEFTLTEAVVESSRKLVKEAAVIICIKNKEFEKASKILKKHMSKDPTTQKLRNDLLNIIREKNLAHPVIQNFSYETFQQKMLRFLESHLDDAEPYLLTMAKKALKSESAASSTGKEDKQPAPGPVEKPPREPARQLRNPPTTIGMMTLKAAFKTLSGAQDSEAAFAKLDQKDLVLPTQALPASPALKNKRPRKDENESSAPADGEGGSELQPKNKRMTISRLVLEEDSQSTEPSAGLNSSQEAASAPPSKPTVLNQPLPGEKNPKVPKGKWNSSNGVEEKETWVEEDELFQVQAAPDEDSTTNITKKQKWTVEESEWVKAGVQKYGEGNWAAISKNYPFVNRTAVMIKDRWRTMKRLGMN
Other choices were:
I obtained the mRNA sequence for TERF2 from NCBI (RefSeq: NM_005652.5).
The provided Twist Biosciences Codon Optimization link is defunct. I therefore used Vector Builder where I provided the protein sequence (DNA/RNA sequences can also be provided here) and optimized it against cleavage sites of:
four restriction enzymes BbsI, BsaI, BsmAI, & BsmI
ATGGCCGCAGGAGCCGGCACAGCTGGGCCCGCCTCCGGTCCCGGAGTGGTGAGGGATCCAGCTGCCTCCCAGCCCAGAAAGCGCCCCGGCAGAGAGGGCGGCGAGGGCGCCCGCCGAAGCGATACTATGGCCGGAGGCGGAGGCTCCTCCGATGGTTCAGGCAGAGCAGCAGGCCGCCGGGCCTCCAGATCCTCCGGCCGCGCCCGGCGCGGCAGACACGAACCTGGGCTTGGAGGGCCCGCCGAGAGGGGCGCCGGCGAGGCCAGACTGGAGGAGGCCGTGAACCGGTGGGTGCTGAAGTTCTATTTTCACGAGGCCCTGAGAGCCTTTAGGGGGAGCCGGTATGGCGATTTTAGACAGATCAGGGATATTATGCAGGCCCTGCTGGTGCGCCCTCTGGGAAAAGAGCACACCGTGAGCAGACTGCTGAGAGTGATGCAGTGCCTGTCCCGCATCGAGGAGGGCGAAAATCTCGATTGCAGCTTTGACATGGAAGCAGAGCTCACTCCCCTGGAAAGCGCCATCAATGTGCTGGAAATGATCAAGACCGAATTCACCCTGACCGAGGCCGTGGTGGAGTCCTCACGGAAACTGGTTAAGGAGGCTGCCGTGATCATTTGCATTAAGAATAAGGAGTTCGAGAAGGCTAGCAAGATTCTGAAGAAGCACATGTCTAAGGACCCAACAACACAGAAACTGAGGAACGACCTGCTGAACATTATCAGAGAGAAGAACCTGGCCCACCCTGTGATCCAGAATTTCAGCTACGAAACATTCCAGCAGAAAATGCTGAGGTTTCTGGAGTCACACCTGGACGATGCCGAGCCTTATCTGCTGACAATGGCCAAGAAGGCTCTTAAGAGCGAGAGCGCCGCCAGCTCTACCGGCAAGGAGGACAAGCAGCCCGCCCCTGGGCCTGTCGAGAAGCCTCCAAGAGAGCCCGCCCGGCAGCTGAGAAACCCTCCCACCACCATCGGGATGATGACACTGAAGGCTGCCTTCAAGACCCTGAGCGGCGCTCAGGACTCAGAGGCCGCTTTTGCCAAGCTGGATCAGAAGGACCTGGTGCTGCCAACCCAAGCCCTGCCTGCCAGCCCCGCCCTGAAAAATAAAAGGCCAAGGAAAGACGAGAATGAATCCAGCGCACCCGCCGATGGAGAGGGGGGCTCCGAGCTTCAGCCCAAGAACAAGCGGATGACTATTTCCAGACTGGTGCTGGAGGAAGATTCCCAGAGCACCGAGCCTTCCGCAGGCCTCAACAGCAGCCAGGAGGCCGCTTCAGCCCCACCCTCCAAGCCAACTGTCCTGAATCAGCCACTCCCCGGAGAGAAGAACCCCAAGGTGCCAAAGGGGAAATGGAATTCCAGCAATGGCGTGGAAGAGAAGGAAACCTGGGTGGAGGAGGATGAGCTGTTTCAGGTGCAGGCCGCCCCTGACGAGGACAGCACTACTAACATCACTAAGAAGCAGAAGTGGACTGTGGAGGAATCCGAGTGGGTGAAGGCCGGCGTGCAGAAATACGGGGAGGGCAATTGGGCTGCCATTTCCAAGAACTACCCCTTCGTGAATCGGACAGCCGTGATGATCAAAGACCGGTGGAGGACAATGAAGCGGCTGGGCATGAACTGA
The organism selected was human, mentioning this allows further optimization of the codon, for this case of the human nuclear protein.
Codon optimization is generally necessary for improving translation efficiency and protein yield (reducing ribosomal pausing and improving folding); the safeguard against specific restriction enzymes is to ensure that the DNA does not get cut in case any of the subsequent future workflows requires usage of such an enzyme…
To synthesize this protein from within my DNA (assuming that it is not already present), we can use some technique to insert the obtained (codon optimized) DNA sequence into a viral vector to insert it inside the human DNA. After successful DNA insertion, the Central Dogma will take care of the rest of the protein synthesis process…
A single gene can code for multiple proteins at the transcriptional level, as there can be multiple start sites, alternate splicing of exons, and the 3-nucleotide reading frame, which can essentially pack three times the information.
Final sequence link for TA to review: https://benchling.com/s/seq-brbMJ6xUPhkDudPrgjLR?m=slm-rCY7ZhowmvIW8w7LoEno.
This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank).
I am interested in developing a sample of mammalian circular DNA (mice, monkeys, etc.), and understand the complications during such DNA replication (to prevent cancers during cell division). Therefore, I am interested in developing a circular DNA (cDNA; clipping away the telomeres) and merging the two ends and then sequencing that entire cDNA. My motive behind this is to disprove my hunch that cDNA is a viable path to human lifespan/healthspan extension!?!
I will use the latest Oxford Nanopore sequencing technique because:
- it can read entire circular DNA molecules without any need for fragmentation
- it can sequence the DNA using rolling-circle–amplified replication
- it uses natural motor enzymes
The Oxford Nanopore third-generation sequencing performs single-molecule sequencing without DNA amplification, producing long reads, and preserves the circular DNA topology.
The input will be the (purified) circular mammalian DNA; no fragmentation and no PCR is required.
A motor enzyme feeds DNA through a biological nanopore; each nucleotide creates a change in ionic current, which can be decoded uniquely.
From the raw electrical signal data (FAST5), long-read nucleotide sequences (FASTQ/FASTA) are derived, which preserve structural information like junctions, repeats, and circular continuity
These could be individual genes, clusters of genes or genetic circuits, whole genomes, and beyond. As described in class thus far, applications could range from therapeutics and drug discovery (e.g., mRNA vaccines and therapies) to novel biomaterials (e.g. structural proteins), to sensors (e.g., genetic circuits for sensing and responding to inflammation, environmental stimuli, etc.), to art (DNA origamis). If possible, include the specific genetic sequence(s) of what you would like to synthesize! You will have the opportunity to actually have Twist synthesize these DNA constructs! :)
I wish to synthesise a mammalian cDNA and probe its self-replicating properties during cellular division (ensuring that the DNA copy generated does not exhibit features of cancer or other abnormalities).
I will use oligonucleotide synthesis followed by enzymatic DNA assembly to construct the full mammalian cDNA, because this approach allows precise sequence control, modular assembly, and is compatible with commercial gene synthesis pipelines (e.g., Twist).
- the approx 1842 nt long DNA is split into 12 overlapping oligos (175 bp each)
- Chemical synthesis of each short DNA oligonucleotides
- Enzymatic assembly of oligos into the full-length cDNA
- Possibly high error rates as sequence length nears the limit of 200 bp for oligonucleotide synthesis; this can be bypassed by splitting DNA further
- Whole-genome or very large circular constructs may require multi-step assembly
In class, George shared a variety of ways to edit the genes and genomes of humans and other organisms. Such DNA editing technologies have profound implications for human health, development, and even human longevity and human augmentation. DNA editing is also already commonly leveraged for flora and fauna, for example in nature conservation efforts, (animal/plant restoration, de-extinction), or in agriculture (e.g. plant breeding, nitrogen fixation). What kinds of edits might you want to make to DNA (e.g., human genomes and beyond) and why?
I am interested to edit DNA of most test aminals (ncluding but not limited to, C elegans, fruitflies, mice, monkeys, etc.) starting from the smaller organisms to large mammals. However this is not gene editing; simply clipping off the telomeres and joining the ends of each linear chromosome to make it circular. Next I wish to observe cell-division processes and how such cDNA fares in large animals (mapping out the Hayflick limit changes due to this alternation).
Additionally, I am interested in looking into telomere maintenance and end-protection, especially if their controlled modulation can extend cellular lifespan without inducing genomic instability or cancer.
There seem to be enzymes that are already used to develop circular DNA from linear DNA by clipping telomeres and joining both ends:
- Restriction Endonucleases make staggered cuts in linear DNA
- DNA Ligase joins the ends of linear DNA fragments together
- Protelomerase specifically resolves telomeres, converting linear DNA into circular form
I am also interested in looking at CRISPR-based editors for targeted modifications in case it is necessary to arrest certain telomere(-ase) or related pathways.
The main challenges are in delivering edits uniformly across all chromosomes, and the high risk of genomic instability (especially during cell divisions). Therefore, all experiments will be restricted to somatic cells in model organisms, and will need extensive validation steps.
Additionally, smaller circular DNA exhibits torsion; in case this might also be a concern when large mammalian DNA is made circular, mechanisms to periodically release the torsion need to be developed (whether such a system may be necessary also needs to be ideated -- requires expert guidance and advice).