Santanu Banerjee

HTGAA Spring 2026

Linear DNA
Linear DNA and Telomere Attrition
Human chromosomes (and most eukaryotes) contain Linear DNA at the ends of which are telomeres which are long repititive DNA sequences. In linear chromosomes, DNA polymerase cannot fully replicate chromosome ends, leading to progressive shortening with each cell division. Telomeres help prevent loss of useful information during DNA replication and, in turn, are shortened with each cell division.
Hayflick limit
Hayflick Limit and Replicative Ageing
The shortening of telomeres is termed Telomere Attrition, and this is one of the 13 hallmarks of ageing (biological ageing at the cellular level). The maximum number of times a cell can replicate before cell division stops (due to the telomere region being exhausted) is known as the Hayflick limit (typically 40-60 times for a normal human somatic cell). Methods to increase this limit should positively impact this Ageing Hallmark, while ensuring that excessive telomere length does not lead to unwanted effects (long telomeres are often observed in multiple types of cancer cells).
Circular DNA
Circular DNA without telomeres performing rolling-circle replication [1]
In this individual project (to be formally proposed in the ongoing HTGAA 2026 cohort), I mainly dwell upon two potential approaches that could help remove this nature-imposed cellular replication limit (discovered by Leonard Hayflick) thereby increasing organismal lifespan; the other bottlenecks of lifespan or how whether this will have impact of healthspan are considered out of scope for this project ideation (although I wish to perform experiments on single and multi-cellular organisms regarding the after effects of such synthetic tweaks which could also provide some understanding on the effects on cellular/tissue healthspans).

References

  1. Sakatani, Y., Yomo, T. & Ichihashi, N., Self-replication of circular DNA by a self-encoded DNA polymerase through rolling-circle replication and recombination., Scientific Reports, 2018. https://www.nature.com/articles/s41598-018-31585-1

About me

  • Born in Kolkata, India, I have spent around two-thirds of my life in my hometown (also known as the City of Joy)
  • Zealous to strategize on colonizing planets in our Solar System (favourite: Saturn) with a multi-pronged approach of surviving the Solar Supernovae (1. Moving away from the Sun in search of other stars, as well as 2. Developing heat-resistant materials and organisms to survive the Solar Supernovae event by shifting Earth)
  • I like playing Chess and Football, and solving Problems…
  • Power Engineer (renewable energy systems); Operational Researcher (mathematical modelling and heuristic design for large scale optimization)
  • Contact info: https://www.linkedin.com/in/SanTanBan/

Homework

Labs

Projects

Subsections of Santanu Banerjee

Subsections of Homework

Week 1 HW: Principles and Practices

This page tackles each of the week 1 Class Assignment Questions and the few Homework Assignment Questions from Professors.

Answers to the Class Assignment Questions:

Question 1First, describe a biological engineering application or tool you want to develop and why.
This could be inspired by an idea for your HTGAA class project and/or something for which you are already doing in your research, or something you are just curious about.
Answer 1All living cells perform cell division; however, every cell division causes telomere shortening (Telomeres are protective caps at the ends of chromosomes). The limit of the number of cell divisions till a safe limit, such that no useful information is lost (directly from the DNA; telomeres still get shortened in the process), is known as the Hayflick Limit (discovered by Leonard Hayflick in the 1960s).
Telomerase elongating a telomere
Telomerase elongating a telomere [1]

The process of telomere shortening/attrition is one of the (currently 13) Hallmarks of Ageing; therefore, understanding how to increase this limit will be a game-changer. Scientists & Researchers have been trying to do this using different techniques; the purpose of this HTGAA Individual Project is to suggest a few novel methods and try to understand how implementing them fares wrt. to other methods, as well as understand the bio-technical nuances/problems which might occur due to these changes in the DNA, subsequently, during cell division stages…
The methods to be explored include:
  • Telomerase activity control (to increase Telomere length)
  • Developing a circular DNA (cDNA, from the linear DNA, by joining the two ends)
    • Testing the above (cDNA) approach along with a torsion release mechanism (more on this later)
  • Developing a new protein which can bind at the end of the T and D-Loop of a Telomere and allow the last few nucleotides to be copied (preventing any loss of the DNA during copying)
Question 2Next, describe one or more governance/policy goals related to ensuring that this application or tool contributes to an “ethical” future, like ensuring non-malfeasance (preventing harm). Break big goals down into two or more specific sub-goals.
Below is one example framework (developed in the context of synthetic genomics) you can choose to use or adapt, or you can develop your own. The example was developed to consider policy goals of ensuring safety and security, alongside other goals, like promoting constructive uses, but you could propose other goals for example, those relating to equity or autonomy.
Answer 2To ensure the technology does not cause disruption in the evolutionary process of species, biosystems, etc. or allow the development of bioweapons, a few governance or policy goals are suggested.
  • Extending Deep Understanding of Potential (malicious) Use-cases: Understand (new) possible pathways that can arise from the technology itself or as an application of the underlying technology; identify potentially promising pathways which may lead to unintended outcomes and leverage mechanisms to halt them, thereby ensuring biosecurity.
  • Increasing Traceability and Improving Transparency: It is necessary to understand (holistically) the current (government/private research) labs that have mastered the technology and keep track of their proliferation intent.
  • Approving appropriate Biosafety levels[2] for eliminating environmental contamination possibilities, and ensuring the safety standards are upheld throughout: Initially classifying necessary biosafety standards that may be appropriate for this kind of experimentation (with a considerable factor of safety), followed by, (a-)periodic lab checks to ensure all lab facilities are up to the mark (and even red-teaming efforts to understand internal sabotage potential) should be performed (maybe by independent organisations or an overseeing body).
Question 3Next, describe at least three different potential governance “actions” by considering the four aspects below (Purpose, Design, Assumptions, Risks of Failure & “Success”).
Try to outline a mix of actions (e.g. a new requirement/rule, incentive, or technical strategy) pursued by different “actors” (e.g. academic researchers, companies, federal regulators, law enforcement, etc). Draw upon your existing knowledge and a little additional digging, and feel free to use analogies to other domains (e.g. 3D printing, drones, financial systems, etc.).
Purpose: What is done now and what changes are you proposing?
Design: What is needed to make it “work”? (including the actor(s) involved - who must opt-in, fund, approve, or implement, etc)
Assumptions: What could you have wrong (incorrect assumptions, uncertainties)?
Risks of Failure & “Success”: How might this fail, including any unintended consequences of the “success” of your proposed actions?
Answer 3
  • Action Plan A:
    Purpose: Build a network of organizations/institutions that possess the technology or are working to develop the same, and allow cautious expansion of the network, while continually assessing the "(state) intent to proliferate"[3]. Develop a Knowledge Graph/Tree of research labs and individuals who have technical know-how about the scientific technology and are pursuing active research in the same topic.
    Design: Incentivise collaboration within the network and regularly educate (through conferences and seminars) about the necessity to have strict access controls for proliferation prevention.
    Assumptions: Organizations/Institutions are assumed to not themselves be bad nodes (in a decentralized system) entirely. Periodically reach out to other labs (that may be able to pivot to the same domain) regarding information of whether they are actively pursuing to develop the same scientific tool (either independently or via collaborations).
    Risks of Failure & “Success”: Possible failure modes include splitting up of a single collaborative structure into two or more frameworks (may be due to ideological differences)...

  • Action Plan B:
    Purpose: Build an Oversight Body which will request reports from the individuals and research labs (from the dynamically expanding knowledge tree) regarding their concerns about proliferation, and especially to understand whether consensus about halting research in the domain (similar to Mirror life[4,5]) needs to be developed immediately or communicated more effectively.
    Design: The oversight body would need to develop partnerships with the national research frameworks of various countries and the United Nations (WHO, etc), allowing a swift trigger of national-level investigations or request international scrutiny in case unchecked proliferation of the technology (either developed independently or through collaboration/technology transfer) is detected from any part of the knowledge tree.
    Assumptions: The recommendations of the Oversight Body are taken seriously by all members, and effective execution of the same is followed swiftly.
    Risks of Failure & “Success”: There is a chance that such a system could become powerless when the individual members have less intent to prosecute or break ties with another member found indulging in questionable practices.

  • Action Plan C:
    Purpose: Leverage biological agent detection kits[6] to continually monitor surrounding areas of each lab.
    Design: Provide capability of risk assessment to discriminate harmful (and harmless) environmental biologics.
    Assumptions: Detection systems are highly effective, set up and monitored by a third party or the overseeing body, and cannot be tampered with by individuals or the surrounding organisation(s).
    Risks of Failure & “Success”: This is the last stage and any contamination detection would mean lapse in some of the previous stages. Essentially, detection of such harmful substances would be code-red for the area and the surrounding regions!
Question 4Next, score (from 1–3, with 1 as best, or n/a) each of your governance actions against your rubric of policy goals:
Answer 4
Does the option:Action Plan AAction Plan BAction Plan C
Identify Malicious Use-cases and Enhance Biosecurity
• By preventing incidents212
• By helping respond221
Increase Traceability, Improve Transparency and Accountability, while Fostering Lab Safety
• By preventing incidents112
• By helping respond321
Ensure Biosafety Levels to prevent contamination and also protect the environment
• By preventing incidents323
• By helping respond331
Other considerations
• Not impede research121
• Promote constructive applications113
Question 5Last, drawing upon this scoring, describe which governance option, or combination of options, you would prioritize, and why. Outline any trade-offs you considered as well as assumptions and uncertainties.
For this, you can choose one or more relevant audiences for your recommendation, which could range from the very local (e.g. to MIT leadership or Cambridge Mayoral Office) to the national (e.g. to President Trump or the head of a Federal Agency) to the international (e.g. to the United Nations Office of the Secretary-General, or the leadership of a multinational firm or industry consortia). These could also be one of the “actor” groups in your matrix.
Answer 5Many of the governance opinions suggested hereinabove are already practised in some or the other form (in varying intensities)[7] to prevent biowarfare. However, with the advent of powerful AI infrastructure allowing real-time decision-making, integration of the proposed Knowledge Tree with a continuous data stream from detection units is a promising future (although enhancing cybersecurity risks), allowing immediate detection of environmental contamination at a wider level than previously possible. Furthermore, an international decentralised governing framework of the technology development direction by the scientific community itself is suggested to prevent misuse and/or proliferation. In this regard, a combination of the Technology-Knowledge Graph of participating members, the establishment of a decentralised Oversight Body, and the leveraging of state-of-the-art biologics detection systems, along with real-time data analysis for immediate threat perception through autonomous (AI-enabled, with human in the loop) decision-making, is key towards the development of a tight-knit, trustworthy and unbiased ecosystem.
Question 6Reflecting on what you learned and did in class this week, outline any ethical concerns that arose, especially any that were new to you. Then propose any governance actions you think might be appropriate to address those issues. This should be included on your class page for this week.
Answer 6Philosophically speaking, the class focused on why D/Acc [8] (i.e. cautiously moving towards technological progress, ensuring existing or in-research technologies cannot cause near-doomsday events or something even close) is more important than E/Acc[9] (a techno-optimistic utopian idea of allowing unrestricted technological progress). For my individual project idea, the ultimate goal is to test the suggested methods on embryos of smaller organisms (such as worms, flies, and mice). The final implementation in larger organisms and humans needs to be handled extremely carefully. Governance mechanisms must ensure that this does not cascade to humans until the holistic, deep after-effects of such methods are well understood; these mechanisms should intend to extend our current understanding of ripple/butterfly effects across massive timescales, e.g. how much of the chromatic/DNA/genetic edits are actually inherited (if at all) and what could be the evolutionary impact of the same.

References

  1. Udroiu, I., Marinaccio, J., & Sgura, A., Many Functions of Telomerase Components: Certainties, Doubts, and Inconsistencies, International Journal of Molecular Sciences, 2022. https://doi.org/10.3390/ijms232315189
  2. Biosafety level, Wikipedia. https://en.wikipedia.org/wiki/Biosafety_level
  3. Nuclear Threat Initiative, NTI | bio proposes new strategies to prevent bioweapons, Dec, 2024. https://www.nti.org/news/nti-bio-proposes-new-solutions-to-prevent-bioweapons-development-and-use/
  4. Zimmer, C., Creating ‘mirror life’ could be disastrous, scientists warn, Scientific American, Dec, 2024. https://www.scientificamerican.com/article/creating-mirror-life-could-be-disastrous-scientists-warn/
  5. Hashemi, S., Scientists weigh the risks of 'mirror life,' synthetic molecules with a reverse version of life's building blocks, Smithsonian Magazine, Sep, 2025. https://www.smithsonianmag.com/smart-news/scientists-weigh-the-risks-of-mirror-life-synthetic-molecules-with-a-reverse-version-of-lifes-building-blocks-180987360/
  6. Ahmad Reza Rezaei, Emergence of techniques to combat biological warfare during and after COVID-19, Preprints.org, Nov, 2024. https://www.preprints.org/manuscript/202411.1220
  7. Gronvall, G. K., Prevention of the development or use of biological weapons, Health Security, 2017. https://doi.org/10.1089/hs.2016.0096
  8. Defensive accelerationism, EverybodyWiki Bios & Wiki, Feb, 2025. https://en.everybodywiki.com/Defensive_Accelerationism
  9. Effective accelerationism, Wikipedia, Jan, 2026. https://en.wikipedia.org/wiki/Effective_accelerationism

Answers to the Homework Assignment Questions:

QuestionsAnswers
~from Professor Jacobson:
1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome? How does biology deal with that discrepancy?DNA polymerase has a raw error rate of approximately 10-4-10-5 errors per nucleotide added; this can cause high errors when compared to the ~3 × 109 base pairs of the human genome, as this can introduce thousands of mutations per cell division.
This discrepancy is tackled through multiple layers of error control, including polymerase proofreading, post-replication mismatch repair, and cell-cycle checkpoints or apoptosis that eliminate heavily damaged cells, reducing the effective mutation rate to ~10-9–10-10 per base per division.
2. How many different ways are there to code (DNA nucleotide code) for an average human protein? In practice what are some of the reasons that all of these different codes don’t work to code for the protein of interest?An average human protein is ~300 amino acids, and each amino acid is encoded by 1–6 synonymous codons (let's take an average of ~3 codons per amino acid). This makes the number of possible DNA sequences encoding the same protein roughly ≈ 3300 ≈ 10143 possible nucleotide sequences.
In practice, synonymous codons can affect translation dynamics and mRNA stability; rare codons affect translation speed & tRNA bias, slowing ribosomes (waiting for low-abundance tRNAs).
~from Dr. LeProust:
1. What’s the most commonly used method for oligo synthesis currently?Phosphoramidite solid-phase synthesis seems the most commonly used method for oligonucleotide (oligo) synthesis currently, as it is an automated chemical process that builds oligonucleotides nucleotide-by-nucleotide on a solid support.
2. Why is it difficult to make oligos longer than 200nt via direct synthesis?Direct chemical synthesis of oligonucleotides longer than 200nt is extremely difficult due to cumulative errors; even a 1% failure per step eliminates >90% of the desired product by 200nt due to error accumulation.
3. Why can’t you make a 2000bp gene via direct oligo synthesis?- Per step error increases exponentially over thousands of cycles, making such a long synthesis impossible
- Longer chains on solid supports block reagent diffusion, dropping coupling efficiency
- Additionally, extremely large quantities of chemicals will be required for the steps (which are performed in batches)
~from George Church:
1. What are the 10 essential amino acids in all animals, and how does this affect your view of the “Lysine Contingency”?10 essential amino acids required by most animals are:
- Histidine
- Isoleucine
- Leucine
- Lysine
- Methionine
- Phenylalanine
- Threonine
- Tryptophan
- Valine
- Arginine
The "Lysine Contingency" from Jurassic Park (1993) was related to genetically engineered dinosaurs unable to synthesise lysine, making them dependent on other lysine sources (thereby making them dependent on humans to feed them Lysine). This is actually not possible as Lysine is already available in meat/fish/grains, etc and even in many single-celled organisms. Thus the dinosaurs could actually still get Lysine from their prey; herbivorous dinosaurs can also obtain Lysine through microbial gut fermentation (through micro-organisms within their guts; it would be impossible for no microbiota to exists as then the digestive system would collapse; it would be another interesting project to understand the consequences of removing all microbiota from a healthy gut of a mouse and seeing the consequences, both computationally via metabolic pathway analysis as well as experimentally).

Week 2 HW: DNA Read, Write, & Edit

This page tackles each of the week 2’s HomeWork Questions.


Part 0:

To understand the basics of Gel Electrophoresis (Gl. Ep.), I watched the following videos:

My understanding of Gl. Ep. is that it simply pulls DNA through a maze, which has channels and pores; each DNA fragment experiences the same force per unit length (so essentially the intended forward acceleration for all DNA fragments would have been the same if there was no friction), but the maze structure creates more resistance/friction to the longer fragments due to which they slow down. Thus we get different bands; unless the pore formation is deterministic and can be atomistically replicated, this is essentially a heuristic which works in real life (as pores in different lanes can also be different; I think there should be a metric to measure if the lanes should have the same weight; this can be achieved by puting the test DNA in the lanes, but also placing a much longer and a much shorter DNA-fragment in all the lane-wells; ideally there should be a straight line formed at the top and bottom (imagine the first and last step of the ladder stretched out across all lanes) and the metric should be how straight the line is! Straighter the line the more holistically equal all the DNA-racing lanes are!).


The answer to the question on this website (under “2. DNA Gel Ladders”) “Because DNA has the same charge per mass for any number of nucleotides, gel electrophoresis separates DNA purely based on length (can you think why?)” is:

~ because the force per unit mass is same, and the only differentiating factor becomes the DNA-travel/movement resistance due to the gel which is proportional to the length (more the length there are more contact points with the gel and longer DNA cant pass through those pores easily, essentially creating a length-specific bottleneck…

Part 1:

Gel Electrophoresis pattern sequence 1a
1. a.
Gel Electrophoresis pattern sequence 1b
1. b.
Image 1 (a, b) reminds us of the shifting temperatures across the globe due to global warming and motivates us to work to prevent climate change.

(Due to lack of time and the problem being a fathomable combinatorial problem, I chose to use my imagination and get the best of whatever sequence was generated; in case any1 is interested in getting hold of a mathematical formulation which can directly output the enzymes required for each lane of a specific design pattern, I can develop such an MILP formulation…)


Gel Electrophoresis pattern sequence 2a
2. a.
Gel Electrophoresis pattern sequence 2b
2. b.
Image 2 (a, b) reminds us of an anomalous intelligence drop in the Gen-Z population (the Reverse Flynn effect), which is possibly an effect of high smartphone/social media/internet usage (and more research may be necessary to understand the actual causes and develop policies to combat them).

Part 2: Not applicable for Global Committed Listeners without Lab access (therefore I am skipping this)

Part 3:

3.1. Choose your protein.

I have chosen the TRF2 (Telomeric Repeat-binding Factor 2); this protein seems to be a good choice given my individual project idea as this protein:

  • binds the T-loop/D-loop directly
  • stabilizes telomere structure
  • prevents end-to-end fusion and DNA damage signalling
  • seems an ideal candidate for telomere protection and/or controlled replication access

The Amino Acid sequence is:

MAAGAGTAGPASGPGVVRDPAASQPRKRPGREGGEGARRSDTMAGGGGSSDGSGRAAGRRASRSSGRARRGRHEPGLGGPAERGAGEARLEEAVNRWVLKFYFHEALRAFRGSRYGDFRQIRDIMQALLVRPLGKEHTVSRLLRVMQCLSRIEEGENLDCSFDMEAELTPLESAINVLEMIKTEFTLTEAVVESSRKLVKEAAVIICIKNKEFEKASKILKKHMSKDPTTQKLRNDLLNIIREKNLAHPVIQNFSYETFQQKMLRFLESHLDDAEPYLLTMAKKALKSESAASSTGKEDKQPAPGPVEKPPREPARQLRNPPTTIGMMTLKAAFKTLSGAQDSEAAFAKLDQKDLVLPTQALPASPALKNKRPRKDENESSAPADGEGGSELQPKNKRMTISRLVLEEDSQSTEPSAGLNSSQEAASAPPSKPTVLNQPLPGEKNPKVPKGKWNSSNGVEEKETWVEEDELFQVQAAPDEDSTTNITKKQKWTVEESEWVKAGVQKYGEGNWAAISKNYPFVNRTAVMIKDRWRTMKRLGMN

Other choices were:

  • POT1 → single-stranded telomere protection
  • TERT → telomerase activity (lengthening)
  • RTEL1 → T-loop unwinding / torsion relief

3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence.

I obtained the mRNA sequence for TERF2 from NCBI (RefSeq: NM_005652.5).

3.3. Codon optimization.

The provided Twist Biosciences Codon Optimization link is defunct. I therefore used Vector Builder where I provided the protein sequence (DNA/RNA sequences can also be provided here) and optimized it against cleavage sites of:

  • two restriction enzymes AccIII and AhaIII

  • four restriction enzymes BbsI, BsaI, BsmAI, & BsmI

       ATGGCCGCAGGAGCCGGCACAGCTGGGCCCGCCTCCGGTCCCGGAGTGGTGAGGGATCCAGCTGCCTCCCAGCCCAGAAAGCGCCCCGGCAGAGAGGGCGGCGAGGGCGCCCGCCGAAGCGATACTATGGCCGGAGGCGGAGGCTCCTCCGATGGTTCAGGCAGAGCAGCAGGCCGCCGGGCCTCCAGATCCTCCGGCCGCGCCCGGCGCGGCAGACACGAACCTGGGCTTGGAGGGCCCGCCGAGAGGGGCGCCGGCGAGGCCAGACTGGAGGAGGCCGTGAACCGGTGGGTGCTGAAGTTCTATTTTCACGAGGCCCTGAGAGCCTTTAGGGGGAGCCGGTATGGCGATTTTAGACAGATCAGGGATATTATGCAGGCCCTGCTGGTGCGCCCTCTGGGAAAAGAGCACACCGTGAGCAGACTGCTGAGAGTGATGCAGTGCCTGTCCCGCATCGAGGAGGGCGAAAATCTCGATTGCAGCTTTGACATGGAAGCAGAGCTCACTCCCCTGGAAAGCGCCATCAATGTGCTGGAAATGATCAAGACCGAATTCACCCTGACCGAGGCCGTGGTGGAGTCCTCACGGAAACTGGTTAAGGAGGCTGCCGTGATCATTTGCATTAAGAATAAGGAGTTCGAGAAGGCTAGCAAGATTCTGAAGAAGCACATGTCTAAGGACCCAACAACACAGAAACTGAGGAACGACCTGCTGAACATTATCAGAGAGAAGAACCTGGCCCACCCTGTGATCCAGAATTTCAGCTACGAAACATTCCAGCAGAAAATGCTGAGGTTTCTGGAGTCACACCTGGACGATGCCGAGCCTTATCTGCTGACAATGGCCAAGAAGGCTCTTAAGAGCGAGAGCGCCGCCAGCTCTACCGGCAAGGAGGACAAGCAGCCCGCCCCTGGGCCTGTCGAGAAGCCTCCAAGAGAGCCCGCCCGGCAGCTGAGAAACCCTCCCACCACCATCGGGATGATGACACTGAAGGCTGCCTTCAAGACCCTGAGCGGCGCTCAGGACTCAGAGGCCGCTTTTGCCAAGCTGGATCAGAAGGACCTGGTGCTGCCAACCCAAGCCCTGCCTGCCAGCCCCGCCCTGAAAAATAAAAGGCCAAGGAAAGACGAGAATGAATCCAGCGCACCCGCCGATGGAGAGGGGGGCTCCGAGCTTCAGCCCAAGAACAAGCGGATGACTATTTCCAGACTGGTGCTGGAGGAAGATTCCCAGAGCACCGAGCCTTCCGCAGGCCTCAACAGCAGCCAGGAGGCCGCTTCAGCCCCACCCTCCAAGCCAACTGTCCTGAATCAGCCACTCCCCGGAGAGAAGAACCCCAAGGTGCCAAAGGGGAAATGGAATTCCAGCAATGGCGTGGAAGAGAAGGAAACCTGGGTGGAGGAGGATGAGCTGTTTCAGGTGCAGGCCGCCCCTGACGAGGACAGCACTACTAACATCACTAAGAAGCAGAAGTGGACTGTGGAGGAATCCGAGTGGGTGAAGGCCGGCGTGCAGAAATACGGGGAGGGCAATTGGGCTGCCATTTCCAAGAACTACCCCTTCGTGAATCGGACAGCCGTGATGATCAAAGACCGGTGGAGGACAATGAAGCGGCTGGGCATGAACTGA
    

The organism selected was human, mentioning this allows further optimization of the codon, for this case of the human nuclear protein.

Codon optimization is generally necessary for improving translation efficiency and protein yield (reducing ribosomal pausing and improving folding); the safeguard against specific restriction enzymes is to ensure that the DNA does not get cut in case any of the subsequent future workflows requires usage of such an enzyme…

3.4. You have a sequence! Now what?

To synthesize this protein from within my DNA (assuming that it is not already present), we can use some technique to insert the obtained (codon optimized) DNA sequence into a viral vector to insert it inside the human DNA. After successful DNA insertion, the Central Dogma will take care of the rest of the protein synthesis process…

3.5. How does it work in nature/biological systems?

A single gene can code for multiple proteins at the transcriptional level, as there can be multiple start sites, alternate splicing of exons, and the 3-nucleotide reading frame, which can essentially pack three times the information.

Part 4: Prepare a Twist DNA Synthesis Order

4.1. Twist account and a Benchling account created

4.2. Build Your DNA Insert Sequence

Final sequence link for TA to review: https://benchling.com/s/seq-brbMJ6xUPhkDudPrgjLR?m=slm-rCY7ZhowmvIW8w7LoEno.

4.3. to 4.6.| My first plasmid: https://benchling.com/s/seq-FhHywDsQ9IWd3ksYDXqa?m=slm-GexKX3FGA9sfzUUrgdLq.

5.1 DNA Read

(i) What DNA would you want to sequence (e.g., read) and why?

This could be DNA related to human health (e.g. genes related to disease research), environmental monitoring (e.g., sewage waste water, biodiversity analysis), and beyond (e.g. DNA data storage, biobank).

I am interested in developing a sample of mammalian circular DNA (mice, monkeys, etc.), and understand the complications during such DNA replication (to prevent cancers during cell division). Therefore, I am interested in developing a circular DNA (cDNA; clipping away the telomeres) and merging the two ends and then sequencing that entire cDNA. My motive behind this is to disprove my hunch that cDNA is a viable path to human lifespan/healthspan extension!?!

(ii) In lecture, a variety of sequencing technologies were mentioned. What technology or technologies would you use to perform sequencing on your DNA and why?

I will use the latest Oxford Nanopore sequencing technique because:
- it can read entire circular DNA molecules without any need for fragmentation
- it can sequence the DNA using rolling-circle–amplified replication
- it uses natural motor enzymes

Is your method first-, second- or third-generation or other? How so?

The Oxford Nanopore third-generation sequencing performs single-molecule sequencing without DNA amplification, producing long reads, and preserves the circular DNA topology.

What is your input? How do you prepare your input (e.g. fragmentation, adapter ligation, PCR)? List the essential steps.

The input will be the (purified) circular mammalian DNA; no fragmentation and no PCR is required.

What are the essential steps of your chosen sequencing technology, how does it decode the bases of your DNA sample (base calling)?

A motor enzyme feeds DNA through a biological nanopore; each nucleotide creates a change in ionic current, which can be decoded uniquely.

What is the output of your chosen sequencing technology?

From the raw electrical signal data (FAST5), long-read nucleotide sequences (FASTQ/FASTA) are derived, which preserve structural information like junctions, repeats, and circular continuity

5.2 DNA Write

(i) What DNA would you want to synthesize (e.g., write) and why?

These could be individual genes, clusters of genes or genetic circuits, whole genomes, and beyond. As described in class thus far, applications could range from therapeutics and drug discovery (e.g., mRNA vaccines and therapies) to novel biomaterials (e.g. structural proteins), to sensors (e.g., genetic circuits for sensing and responding to inflammation, environmental stimuli, etc.), to art (DNA origamis). If possible, include the specific genetic sequence(s) of what you would like to synthesize! You will have the opportunity to actually have Twist synthesize these DNA constructs! :)

I wish to synthesise a mammalian cDNA and probe its self-replicating properties during cellular division (ensuring that the DNA copy generated does not exhibit features of cancer or other abnormalities).

(ii) What technology or technologies would you use to perform this DNA synthesis and why?

I will use oligonucleotide synthesis followed by enzymatic DNA assembly to construct the full mammalian cDNA, because this approach allows precise sequence control, modular assembly, and is compatible with commercial gene synthesis pipelines (e.g., Twist).

What are the essential steps of your chosen sequencing methods?

- the approx 1842 nt long DNA is split into 12 overlapping oligos (175 bp each)
- Chemical synthesis of each short DNA oligonucleotides
- Enzymatic assembly of oligos into the full-length cDNA

What are the limitations of your sequencing method (if any) in terms of speed, accuracy, scalability?

- Possibly high error rates as sequence length nears the limit of 200 bp for oligonucleotide synthesis; this can be bypassed by splitting DNA further
- Whole-genome or very large circular constructs may require multi-step assembly

5.3 DNA Edit

(i) What DNA would you want to edit and why?

In class, George shared a variety of ways to edit the genes and genomes of humans and other organisms. Such DNA editing technologies have profound implications for human health, development, and even human longevity and human augmentation. DNA editing is also already commonly leveraged for flora and fauna, for example in nature conservation efforts, (animal/plant restoration, de-extinction), or in agriculture (e.g. plant breeding, nitrogen fixation). What kinds of edits might you want to make to DNA (e.g., human genomes and beyond) and why?

I am interested to edit DNA of most test aminals (ncluding but not limited to, C elegans, fruitflies, mice, monkeys, etc.) starting from the smaller organisms to large mammals. However this is not gene editing; simply clipping off the telomeres and joining the ends of each linear chromosome to make it circular. Next I wish to observe cell-division processes and how such cDNA fares in large animals (mapping out the Hayflick limit changes due to this alternation).
Additionally, I am interested in looking into telomere maintenance and end-protection, especially if their controlled modulation can extend cellular lifespan without inducing genomic instability or cancer.

(ii) What technology or technologies would you use to perform these DNA edits and why?

How does your technology of choice edit DNA? What are the essential steps? What preparation do you need to do (e.g. design steps) and what is the input (e.g. DNA template, enzymes, plasmids, primers, guides, cells) for the editing? What are the limitations of your editing methods (if any) in terms of efficiency or precision?

There seem to be enzymes that are already used to develop circular DNA from linear DNA by clipping telomeres and joining both ends:
- Restriction Endonucleases make staggered cuts in linear DNA
- DNA Ligase joins the ends of linear DNA fragments together
- Protelomerase specifically resolves telomeres, converting linear DNA into circular form

I am also interested in looking at CRISPR-based editors for targeted modifications in case it is necessary to arrest certain telomere(-ase) or related pathways.

The main challenges are in delivering edits uniformly across all chromosomes, and the high risk of genomic instability (especially during cell divisions). Therefore, all experiments will be restricted to somatic cells in model organisms, and will need extensive validation steps.

Additionally, smaller circular DNA exhibits torsion; in case this might also be a concern when large mammalian DNA is made circular, mechanisms to periodically release the torsion need to be developed (whether such a system may be necessary also needs to be ideated -- requires expert guidance and advice).

Subsections of Labs

Week 1 Lab: Pipetting

cover image cover image

Subsections of Projects

Individual Final Project

cover image cover image

Group Final Project

cover image cover image