Projects

Final projects:

  • Sentinel Microbes: Pathogen Detection Abstract / Project Overview The Sentinel Microbes project focuses on the development of a whole-cell bacterial biosensor based on Escherichia coli for the non-invasive detection of enteric pathogens. This system utilizes a synthetic gene circuit governed by the LuxR-AHL (Acyl-homoserine lactone) quorum sensing mechanism. By detecting exogenous AHL signals—a universal “language” used by Gram-negative pathogens like Salmonella typhimurium—the engineered microbes act as an early warning system, reporting the presence of infection through the expression of Superfolder Green Fluorescent Protein (sfGFP).

Subsections of Projects

Individual Final Project

cover image cover image

Sentinel Microbes: Pathogen Detection

  1. Abstract / Project Overview The Sentinel Microbes project focuses on the development of a whole-cell bacterial biosensor based on Escherichia coli for the non-invasive detection of enteric pathogens. This system utilizes a synthetic gene circuit governed by the LuxR-AHL (Acyl-homoserine lactone) quorum sensing mechanism. By detecting exogenous AHL signals—a universal “language” used by Gram-negative pathogens like Salmonella typhimurium—the engineered microbes act as an early warning system, reporting the presence of infection through the expression of Superfolder Green Fluorescent Protein (sfGFP).

  2. Background & Motivation The human gut microbiome is a complex ecosystem where the early detection of dysbiosis and pathogenic invasion is crucial for clinical intervention. Traditional diagnostic methods, such as stool cultures or PCR, often provide a “snapshot” that may miss the initial stages of infection (Riglar & Silver, 2018).

Synthetic biology offers a solution through “Engineered Living Therapeutics” (ELTs). Many enteric pathogens utilize Quorum Sensing (QS) to coordinate virulence factor expression (Miller & Bassler, 2001). Among these signals, AHLs are the most well-characterized. By repurposing the LuxR receptor from Vibrio fischeri, we can create a “sentinel” that triggers a reporter protein only in the presence of these pathogen-derived molecules.

  1. Design of the Genetic Circuit The genetic architecture is designed as a single-input reporter module. It consists of the following standardized biological parts (BioBricks):
  • Sensor Module (pLuxR - BBa_R0062): An AHL-responsive promoter. In the presence of 3-oxo-C6-HSL (the signal molecule), the LuxR protein (assumed to be constitutively expressed or present in the chassis) binds to this promoter to initiate transcription.

  • Translational Unit (B0034 RBS): A high-efficiency Ribosome Binding Site to ensure robust protein synthesis.

  • Reporter Module (sfGFP): Superfolder GFP was chosen over standard GFP due to its rapid folding kinetics and high stability in the diverse chemical environment of the gut (Pédelacq et al., 2006).

  • Termination Module (B0015): A double terminator to prevent transcriptional read-through and maintain circuit stability.

Below is the final, codon-optimized DNA sequence submitted for synthesis:

acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaaaaaagaggagaaaatgagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactctgacctatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgaaatatacaaatagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

  1. Benchling & Computational Design

The sequence was digitally assembled in Benchling and optimized for the E. coli K-12 chassis to resolve codon bias and eliminate illegal restriction sites (EcoRI, PstI, XbaI, SpeI) in accordance with the RFC10 BioBrick standard.

Insert Length: ~960 bp.

Vector Selection: The circuit is hosted on a pTwist-Kan Medium Copy vector. This selection balances the metabolic burden on the host cell while ensuring sufficient reporter signal strength for detection (Kittleson et al., 2012).

  1. Codon Optimization & Biosecurity Codon Optimization: The sequence was optimized for E. coli expression using the Benchling codon optimization tool to maximize protein yield.

Illegal Site Scrubbing: All restriction sites for EcoRI, PstI, XbaI, and SpeI were removed to maintain RFC10 compatibility.

Complexity Check: The sequence was verified for synthesis feasibility (neutral GC content and absence of long repeats).

  1. Implementation & Future Applications This modular design can be expanded into a “Multiplexed Sentinel System.” Future iterations could include:

Memory Circuits: Utilizing recombinases to “flip” a DNA switch so the signal remains even after the pathogen is cleared (Yang et al., 2014).

Kill-Switches: Implementing a toxin-antitoxin biocontainment system to prevent the escape of GMOs into the environment.

  1. References Miller, M. B., & Bassler, B. L. (2001). Quorum sensing in bacteria. Annual Review of Microbiology, 55(1), 165-199.

Pédelacq, J. D., et al. (2006). Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology, 24(1), 79-88.

Riglar, K. T., & Silver, P. A. (2018). Engineering bacteria for diagnostic and therapeutic applications in the gut. Nature Reviews Microbiology, 16(4), 214-225.

Yang, L., et al. (2014). Permanent genetic memory with DNA-based re-writable registers and logic gates. Nature Methods, 11(12), 1261-1266.

  1. Supplies & Estimated Cost The following is an estimate for the synthesis and cloning of the Sentinel Microbes construct:

Item : “Estimated Price” Gene Synthesis (~960 bp Insert) : “$86.40” Cloning Service (into pTwist-Kan) : “$50.00” International Shipping : “$40.00” Estimated Total Cost : “$176.40”

Group Final Project

cover image cover image