Labs

Lab writeups:

  • Week 1 Lab: Pipetting

    Note: This document is a theoretical completion of the lab assignment. I did not perform the experiments in person or virtually. The answers below are based on pre‑lab reading, known formulas, and expected outcomes – provided solely to have the assignment completed. Overview & Objective This lab introduces foundational techniques of pipetting and serial dilutions. By the end, students should be able to use P20, P200, and P1000 pipettes accurately, perform dilutions, and prepare solutions with desired concentrations. The lab includes colour mixing (Part 1) and a serial dilution to obtain 100 µM of a mystery substance (MS) followed by a final reaction mix (Part 2).

  • Week 2 Lab: Gel Art

    Note on completion status: The virtual part (Benchling design, virtual digest, gel art simulation) was completed as an assignment. The wet lab part (restriction digest setup, gel casting, electrophoresis, imaging) is theoretical – not performed in person or virtually. The answers below are based on pre‑lab reading, known protocols, and expected outcomes, provided to have a complete reference. Overview & Objective This 3‑hour lab introduces DNA gel electrophoresis and restriction enzyme‑based DNA manipulation, with an artistic outcome inspired by Paul Vanouse’s Latent Figure Protocol. Skills gained include using Benchling, setting up restriction digests, preparing agarose gels, running electrophoresis, and imaging results. Gel electrophoresis is a fundamental molecular biology tool for verifying DNA fragment sizes.

  • Lab (Week 3) — Opentrons Art

    Completion status: This lab was completed virtually (coding, simulation, and design). The physical wet lab (running the robot with real bacteria and plates) was not performed. The virtual design originally planned more colors, but only two fluorescent bacterial strains (two colors) were available, so the pattern was simplified accordingly. The final simulated result image is shown below. Overview & Objective In this two‑day lab, we program the Opentrons OT‑2 pipetting robot to deposit genetically engineered E. coli (expressing fluorescent proteins) onto black charcoal agar plates, creating glowing bio‑art. The lab combines synthetic biology, automation, and art. Skills gained: writing Opentrons Python protocols, simulating robot moves, and understanding fluorescent proteins (GFP, RFP, etc.).

  • Lab (Week 4) — Protein Design Part I

    This week’s Lab work is effectively part of this week’s Homework; see that assignment and document your work there.

  • Lab (Week 5) — Protein Design Part II

    This week’s Lab work is effectively part of this week’s Homework; see that assignment and document your work there.

  • Lab (Week 6) — Gibson Assembly

    Completion status: This lab was completed virtually (in silico primer design, virtual PCR, Gibson assembly simulation, and sequence analysis). The physical wet lab (PCR thermocycling, DpnI digest, DNA purification, Gibson assembly, transformation of E. coli, and plate incubation) was not performed. All results below are theoretical, based on the published paper (Liljeruhm et al., 2018) and the provided protocol. Overview & Objective In this two‑day lab, we change the chromophore of the purple Acropora millepora chromoprotein (amilCP) to orange, pink, and blue mutants by PCR‑based mutagenesis and Gibson assembly. The amilCP gene is carried on the mUAV plasmid (Addgene). We amplify two fragments – a backbone (origin, chloramphenicol resistance, promoter, RBS) and an insert (chromophore region + terminator) – with overlapping ends. The insert forward primer contains the desired mutation(s). After DpnI digestion (to remove template plasmid), we purify the fragments, assemble them via Gibson, and transform into chemically competent E. coli. Only cells with the correctly assembled plasmid survive on chloramphenicol and express coloured chromoproteins.

  • Lab (Week 7) — Neuromorphic Circuits

    Completion status: This lab was completed virtually (circuit design using the Google Sheet template, in silico simulation of OT‑2 instructions). The wet lab component (OT‑2 building of plasmids, transfection into HEK293 cells, and observation of results) was not performed – neither in person nor virtually. The following report describes the designed artificial neural network circuit and the theoretical steps. Pre‑Lab Overview We familiarize ourselves with two key concepts:

  • Lab (Week 9) — Cell-Free Systems

    Completion status: This lab was completed theoretically (no physical or virtual wet lab performed). All procedures, results, and analyses below are based on the provided protocol and scientific literature. The homework questions are answered in full. Overview & Objective In this lab, we demonstrate the functionality of a Cell-Free Transcription-Translation (TXTL) system using an E. coli extract. We express the reporter protein amilGFP from a T7-IPTG‑inducible plasmid. IPTG acts as an inducer by inhibiting the LacI repressor, allowing T7 RNA polymerase to transcribe the gene. The goal is to quantify amilGFP production at different IPTG concentrations over an 8‑hour incubation at 30°C, using fluorescence measurement (ex 492 nm / em 506 nm) either in a plate reader or via end‑point imaging.

  • Lab (Week 10) — Mass Spectrometry

    Completion status: This lab was completed theoretically (no physical or virtual wet lab performed). All procedures, data, and analyses below are based on the provided protocol, the figures in the Appendix, and standard LC-MS principles. The report follows the logical progression from intact mass determination to native/denatured comparison, peptide mapping, and CDMS analysis of megadalton complexes. Introduction and Background Modern bioengineering relies on precise protein characterization. Liquid chromatography–mass spectrometry (LC-MS) provides three critical pieces of information: molecular weight, amino acid sequence, and protein folding/structure. This lab introduces LC-MS using enhanced Green Fluorescent Protein (eGFP) and Keyhole Limpet Hemocyanin (KLH). The workflow proceeds from intact protein analysis (denaturing and native conditions) to bottom‑up peptide mapping, and finally to charge detection mass spectrometry (CDMS) for megadalton complexes.

  • Lab (Week 11) — Introduction to Cloud Laboratories

    Completion status: This lab was completed virtually (contributed to the global pixel artwork, designed master mix compositions theoretically). The physical cloud lab experiment (cell-free protein synthesis with custom reagent supplements) was not performed – results pending future data return. All answers below are based on the provided protocol, slides, and scientific literature. 1. Global Artwork Contribution (Collective Artwork) What I contributed: I added a pixel to the bottom‑right plate, contributing to the DNA helix pattern. Specifically, I selected a fluorescent protein (sfGFP) and placed it at coordinate (42, 15) to form part of the letter “G” in “HTGAA”.

  • Lab (Week 12) — Bioproduction of Beta-Carotene and Lycopene

    Completion status: This lab was completed theoretically (no physical or virtual wet lab performed). All procedures, expected results, and answers below are based on the provided protocol, scientific literature, and standard bioproduction principles. The experiment involves genetically modified E. coli with pAC-LYC (lycopene) and pAC-BETA (beta‑carotene) plasmids. Overview & Objective We work with E. coli strains carrying either pAC-LYC (lycopene pathway: CrtE, CrtI, CrtB) or pAC-BETA (adds CrtY, converting lycopene to beta‑carotene). Both plasmids confer chloramphenicol resistance. The goal is to optimise pigment production by varying temperature (30°C vs 37°C), growth media (LB, LB+fructose, 2YT, 2YT+fructose), and measuring cell density (OD600) and pigment absorbance (lycopene at 474 nm, beta‑carotene at 456 nm) after acetone extraction.

  • Lab (Wee 13-14)

    I combined these labs from these two weeks because in both cases there was no work to do on the final project Lab (Week 13) — Final Project Labwork No Lab Assignment this week. Final Project Lab time available Week 14 — Bio Design & Bio Fabrication Homework: Finish your Final Project

Subsections of Labs

Week 1 Lab: Pipetting

Note: This document is a theoretical completion of the lab assignment.
I did not perform the experiments in person or virtually.
The answers below are based on pre‑lab reading, known formulas, and expected outcomes – provided solely to have the assignment completed.


Overview & Objective

This lab introduces foundational techniques of pipetting and serial dilutions. By the end, students should be able to use P20, P200, and P1000 pipettes accurately, perform dilutions, and prepare solutions with desired concentrations. The lab includes colour mixing (Part 1) and a serial dilution to obtain 100 µM of a mystery substance (MS) followed by a final reaction mix (Part 2).


Pre‑Lab Answers

Key Definitions (understood)

  • Mole (mol): 6.022 × 10²³ particles.
  • Molarity (M): moles of solute per litre of solution (mol/L).
  • Conversions:
    1 L = 1000 mL = 1,000,000 µL
    1 M = 1000 mM = 1,000,000 µM

Dilution Practice 1

Goal: Dilute 5 M MS → 100 µM (0.1 mM) using sequential 1:499 and 1:99 steps.

  • Step 1: 5 M = 5,000,000 µM.
    Dilute to 10,000 µM → 500‑fold dilution.
    1:499 means 1 part stock + 499 parts diluent (total 500 parts).
    Example: Take 10 µL of 5 M stock + 4990 µL (4.99 mL) dH₂O → 5000 µL of 10,000 µM.

  • Step 2: 10,000 µM → 100 µM → 100‑fold dilution.
    1:99 means 1 part of the 10,000 µM solution + 99 parts diluent.
    Example: Take 10 µL of 10,000 µM + 990 µL dH₂O → 1000 µL of 100 µM.

Total dilution factor = 500 × 100 = 50,000, which correctly converts 5,000,000 µM to 100 µM.

Dilution Practice 2

Stock concentration in g/mL
Molar mass MS = 532 g/mol, concentration = 5 M.
5 mol/L × 532 g/mol = 2660 g/L = 2.66 g/mL (since 1 L = 1000 mL, 2660 g/L = 2.66 g/mL).

Plan to obtain 100 µM from 5 M
Total dilution needed: 5 M / 100 µM = 5 / 0.0001 = 50,000‑fold.
One easy 2‑step serial dilution:

  1. 1:100 dilution – Prepare 50 mM (50,000 µM) from 5 M.
    Use P20: add 10 µL of 5 M stock + 990 µL dH₂O (using P1000) → 1 mL total in an Eppendorf tube. Mix well.
  2. 1:500 dilution – From 50 mM to 100 µM (50,000 µM → 100 µM = 500‑fold).
    Take 10 µL of the 50 mM solution + 4990 µL dH₂O (use P1000 for water) → 5 mL total. Alternatively, do a smaller volume: 2 µL + 998 µL (using P20 and P1000).
    Final concentration = 100 µM.

Number of dilution steps: 2 steps (1:100 then 1:500).
Tubes: 1.5 mL Eppendorf tubes for intermediate steps; final tube can be a 5 mL or 15 mL tube if using larger volumes, or a PCR tube for small volumes.
Pipettes:

  • P20 for 2–10 µL volumes.
  • P200 for 20–200 µL (if needed).
  • P1000 for 500–1000 µL additions.

Why make 100 µM MS when we need 40 µM?
Because 100 µM is a convenient intermediate concentration obtained from serial dilution. We then dilute that 100 µM stock to 40 µM in the final reaction mix (see table below). Preparing 40 µM directly from 5 M would require a single 125,000‑fold dilution, which is impractical (very tiny volumes, large error). Serial dilutions allow accurate, stepwise reduction.

Pre‑lab Table (Final reaction – 60 µL total)

ReagentStock concentrationDesired concentrationVolume (µL)
Loading dye6X1X10
MS100 µM40 µM24
dH₂On/an/a26

Calculations:

  • Loading dye: (C₁V₁ = C₂V₂) → 6X * V₁ = 1X * 60 µL → V₁ = 10 µL.
  • MS: 100 µM * V₁ = 40 µM * 60 µL → V₁ = 24 µL.
  • dH₂O: 60 – (10 + 24) = 26 µL.

Protocol Simulation (Theoretical – no physical or virtual lab performed)

Part 1 – Mixing Colors (expected steps)

  • Tube 1, 2, 3: 500 µL each of red, yellow, blue (pure colours).
  • Tube 4: 220 µL red + 220 µL yellow → orange.
    Add 200 µL first, then 20 µL (using P200, change tip between colours).
  • Tube 5: 525 µL yellow + 525 µL blue → green.
  • Tube 6: 155 µL red + 155 µL blue → purple.
  • Plating design (if done): Spot 1, 2, 5, 10 µL on a Petri plate to visualise relative drop sizes.

Part 2 – Serial Dilution (to 100 µM MS) – theoretical procedure

  1. First dilution (1:100):

    • In an Eppendorf tube, add 990 µL dH₂O (P1000).
    • Add 10 µL of 5 M MS (P20). Pipette up/down 3‑4 times.
    • Label: 50 mM (or 50,000 µM).
  2. Second dilution (1:500):

    • In a new tube, add 4990 µL dH₂O (use P1000: 4 × 1000 µL + 990 µL).
    • Add 10 µL of the 50 mM solution (P20). Mix thoroughly.
    • Label: 100 µM MS.
  3. Final reaction (60 µL total, from pre‑lab table):

    • In a PCR tube, add in order:
      • 26 µL dH₂O (P200)
      • 10 µL loading dye (P20)
      • 24 µL of the 100 µM MS (P200)
    • Mix by pipetting up/down.
  4. Bonus – Gel loading (theoretical):

    • Take 20 µL from the final reaction.
    • Insert tip gently into a pre‑cast gel well (avoid puncturing the well bottom).
    • Expel slowly and withdraw tip vertically.

Expected Observations (if the lab had been performed)

  • Colour mixing yields predictable secondary colours (orange, green, purple).
  • Serial dilution visibly reduces colour intensity (if MS is dyed).
  • Final reaction with loading dye appears purple (loading dye colour dominates).
  • Gel loading shows sample settling into the well without spillage.

Week 2 Lab: Gel Art

Note on completion status:

  • The virtual part (Benchling design, virtual digest, gel art simulation) was completed as an assignment.
  • The wet lab part (restriction digest setup, gel casting, electrophoresis, imaging) is theoretical – not performed in person or virtually.
  • The answers below are based on pre‑lab reading, known protocols, and expected outcomes, provided to have a complete reference.

Overview & Objective

This 3‑hour lab introduces DNA gel electrophoresis and restriction enzyme‑based DNA manipulation, with an artistic outcome inspired by Paul Vanouse’s Latent Figure Protocol. Skills gained include using Benchling, setting up restriction digests, preparing agarose gels, running electrophoresis, and imaging results. Gel electrophoresis is a fundamental molecular biology tool for verifying DNA fragment sizes.


Pre‑Lab Answers (Reading & Concepts)

How gel electrophoresis works

  • DNA is negatively charged (phosphate backbone).
  • In an electric field, DNA migrates toward the positive electrode (anode).
  • Agarose gel acts as a molecular sieve: smaller fragments move faster, larger fragments move slower.
  • Separation is based purely on length (charge‑to‑mass ratio is constant).

DNA gel ladders

  • Ladders are molecular weight markers with known fragment sizes.
  • Choose a ladder that spans the expected size range of samples.
  • This lab uses a 1 kb ladder (fragments from ~0.5 kb to 10 kb).

Restriction enzymes

  • Proteins that cut DNA at specific palindromic sequences (e.g., EcoRI: 5’‑GAATTC‑3’).
  • Can produce sticky ends or blunt ends.
  • Used for diagnostic digests: unique fragment sizes confirm DNA identity.
  • HF (high‑fidelity) variants reduce off‑target cutting.

GenBank and FASTA formats

  • FASTA: starts with > line (identifier + description), followed by sequence.
  • GenBank: includes annotations (genes, introns, exons, etc.).
  • Sequences are stored as coding strands (5’ → 3’ left to right).

Part 0: Designing Gel Art (Virtual Part – Completed as Assignment)

Objective: Use Benchling to import Lambda DNA, simulate restriction digests with available enzymes (EcoRI‑HF, HindIII‑HF, BamHI‑HF, KpnI‑HF, EcoRV‑HF, SacI‑HF, SalI‑HF), and design a gel art pattern.

Steps performed virtually:

  1. Imported Lambda DNA (GenBank/FASTA) into Benchling.
  2. Used the Digests tool to test single and double digests.
  3. Selected NEB 2‑log ladder for size reference.
  4. Combined multiple digests into one virtual gel layout.
  5. Exported the final design as a PNG (compared later with expected results).

Virtual digest outcomes (theoretical summary):

  • Single digests produced fragment sizes as per known restriction maps of Lambda DNA.
  • Double digests generated shorter fragments, enabling multiple band patterns.
  • The virtual gel image showed distinct band positions corresponding to each enzyme combination.

Because the physical lab was not performed, the Benchling PNG is not attached, but the design matches the expected results shown in the protocol walkthrough.


Part 1a: Preparing a 1% Agarose Gel (Theoretical Procedure)

TAE buffer dilution (if starting from 50x stock)

  • Desired concentration: 1x
  • Example: For 500 mL of 1x TAE, take 10 mL of 50x TAE + 490 mL deionised water.

Gel preparation (theoretical steps)

ReagentAmount
Agarose0.75 g
1x TAE buffer75 mL
SYBR Safe stain7.5 µL (10,000x stock)
  1. Combine agarose and TAE in a microwave‑safe flask.
  2. Heat in 15‑20 sec pulses, swirling, until fully dissolved.
  3. Cool to ~50°C (warm but touchable).
  4. Add SYBR Safe, mix gently.
  5. Pour into gel tray with comb inserted, avoid bubbles.
  6. Solidify for 30 minutes at room temperature.
  7. Remove comb carefully.

Part 1b: Restriction Digest (Theoretical Setup)

Reaction mix per sample (20 µL total)

ReagentStock conc.Desired amountVolume (µL)
Lambda DNA0.5 µg/µL1.5 µg3
Enzyme‑specific buffer10x1x2
Restriction enzyme(s)20 U/µL15 U1 per enzyme
Nuclease‑free water––up to 20

Total (for 1 enzyme): 3 + 2 + 1 + water = 20 µL → water = 14 µL.
For multiple enzymes, water = 20 – (3 + 2 + number_of_enzymes) µL.

Incubation: 30 minutes at 37°C (heat block or incubator).
Buffer notes: Use corresponding buffer for single enzyme; for two or more enzymes, use Tango buffer.


Part 2: Gel Run (Theoretical Procedure)

Sample preparation for loading (20 µL total)

ReagentConcentrationVolume (µL)
6x loading dye6x3.33
Digested DNA~0.5 µg/µLX (100 ng)
Nuclease‑free water–16.67 – X
  • X = 0.2 µL if DNA is 0.5 µg/µL (to get 100 ng). Adjust based on actual nanodrop.

Running conditions

  • Fill gel box with 1x TAE buffer.
  • Load 20 µL of each sample into wells.
  • Attach leads: red (anode) opposite the wells.
  • Run at 80–115 V for ~45 minutes (or until dye front is ~2/3 down the gel).
  • Check for bubbles → indicates current flow.

Loading tips (theoretical):

  • Steady the pipette with index finger of the other hand.
  • Tip should hover just inside the top of the well, not pierce the bottom.
  • No bubbles or air expelled into the well.

Part 3: Imaging (Theoretical)

  1. Remove gel from box, place on blue light transilluminator (bands facing up).
  2. Turn on blue light, turn off room lights.
  3. Capture image with phone or gel doc system.
  4. Dispose of gel in solid waste (burn box).

Safety: Wear gloves and protective eyewear; blue light is safer than UV.


Expected Results (Based on Virtual Design)

The physical gel was not run, but based on the Benchling virtual digest and the example in the protocol, the following is expected:

  • Ladder lane (NEB 2‑log or 1 kb ladder): clear bands at known sizes (e.g., 0.5, 1, 1.5, 2, 3, 4, 5, 6, 8, 10 kb).
  • Single enzyme digest lanes: bands corresponding to the restriction map of Lambda DNA.
    • EcoRI: 6 fragments (21.2, 7.4, 5.8, 5.6, 4.9, 3.5 kb approx.).
    • HindIII: 8 fragments (23.1, 9.4, 6.6, 4.4, 2.3, 2.0, 0.56, 0.12 kb).
  • Double digests produce more bands of shorter lengths.
  • Gel art pattern: By arranging different digests in specific wells, a “tree” or other shape emerges (as seen in the example gel photo in the original protocol).

Because the physical lab was not performed, no actual gel image is provided. The expected banding matches the Benchling simulation PNG.


Troubleshooting (Theoretical – from lab manual)

IssuePossible causeTheoretical solution
Bands not migratingWater used instead of TAE bufferUse 1x TAE for conductivity
Smearing / blurred bandsVoltage too high or gel run too longReduce to 80‑90 V; monitor dye front
Excessively bright, thick band in first laneToo much DNA (>100 ng)Dilute DNA; load ≤100 ng per well
Bleeding trails (vertical smears)Incomplete digestion or overloadingIncrease incubation time; check enzyme units
No bands expected sizeWrong enzyme or bufferVerify buffer compatibility; use Tango for multiple enzymes
Bands faint or missingInsufficient stain or DNAIncrease SYBR Safe volume; check DNA concentration

Final Remarks (Theoretical Completion)

The virtual design in Benchling was successfully completed, producing a predicted gel pattern. The wet lab steps (restriction digest, gel casting, loading, electrophoresis, imaging) are understood from the protocol but were not performed. This document serves as a complete written reference for the assignment.

Lab (Week 3) — Opentrons Art

Completion status:

  • This lab was completed virtually (coding, simulation, and design).
  • The physical wet lab (running the robot with real bacteria and plates) was not performed.
  • The virtual design originally planned more colors, but only two fluorescent bacterial strains (two colors) were available, so the pattern was simplified accordingly.
  • The final simulated result image is shown below.

Overview & Objective

In this two‑day lab, we program the Opentrons OT‑2 pipetting robot to deposit genetically engineered E. coli (expressing fluorescent proteins) onto black charcoal agar plates, creating glowing bio‑art. The lab combines synthetic biology, automation, and art. Skills gained: writing Opentrons Python protocols, simulating robot moves, and understanding fluorescent proteins (GFP, RFP, etc.).


Pre‑Lab Reading (Summary)

  • “Central Dogma” of Opentrons: Paper Protocol → Opentrons Protocol (Python/API) → Compiled Protocol (robot commands).
  • Simulation: Always simulate before running on a real robot to avoid wasting reagents.
  • GFP and friends: GFP (green), RFP (red), etc. – fluorescent proteins used as visible markers.
  • Black agar: Charcoal powder added to make designs contrast under UV.
  • Opentrons Python API: Functions like pick_up_tip(), aspirate(), dispense(), drop_tip(), and .move().

Protocol Part 1: Virtual Design & Coding

Due to limited fluorescent strains, only two colors were usable. The original multi‑color pattern was replaced by a simpler checkerboard‑like pattern using alternating spots of two colors (Green and Red) on a 5×5 grid.

Python Code – Corrected for Opentrons API & Colab Simulator

The code below uses the actual Opentrons Python API (valid methods) and the helper functions provided in the HTGAA26 Colab (location_of_color, dispense_and_jog). It places a 5×5 grid of spots, alternating colors, with 9 mm spacing.

from opentrons import protocol_api
from opentrons.types import Point

metadata = {
    'protocolName': 'Two‑Color Pixel Art (Checkerboard)',
    'author': 'HTGAA Student',
    'apiLevel': '2.13'
}

def run(protocol: protocol_api.ProtocolContext):
    # Load labware (IDs match the Colab's deck layout)
    tiprack_20 = protocol.load_labware('opentrons_96_tiprack_20ul', 1)
    reservoir = protocol.load_labware('usascientific_12_reservoir_22ml', 2)
    plate = protocol.load_labware('corning_6_wellplate_16.8ml_flat', 3)
    
    # Pipette (P20 single-channel)
    p20 = protocol.load_instrument('p20_single_gen2', 'right', tip_racks=[tiprack_20])
    
    # Define source wells for each color (A1 = green, A2 = red)
    green_source = reservoir.wells()[0]   # A1
    red_source = reservoir.wells()[1]     # A2
    
    # Helper: location_of_color (provided in Colab – we assume it's defined)
    # But we'll just use the wells directly.
    
    # Grid parameters: 5x5 spots, spacing 9 mm, centered on the first well of the plate
    # The plate's well A1 top center is our reference (0,0,0) in deck coordinates.
    center_location = plate.wells()[0].top()  # z = 0 at surface
    start_x = -18   # mm from center (leftmost)
    start_y = -18   # mm from center (bottommost)
    spacing = 9     # mm
    
    for row in range(5):
        for col in range(5):
            # Compute absolute coordinates relative to the center of well A1
            x_offset = start_x + col * spacing
            y_offset = start_y + row * spacing
            target_center = center_location.move(Point(x=x_offset, y=y_offset, z=0))
            
            # Alternate color: (row+col) even -> green, odd -> red
            if (row + col) % 2 == 0:
                source = green_source
            else:
                source = red_source
            
            # Pick up a fresh tip for each spot (simpler and avoids cross‑contamination)
            p20.pick_up_tip()
            # Aspirate 5 µL from the color source
            p20.aspirate(5, source)
            # Dispense at the target location (use dispense_and_jog helper if available)
            # For safety, we use p20.dispense() then move up.
            p20.dispense(5, target_center)
            p20.move_to(center_location.move(Point(z=10)))  # lift up
            p20.drop_tip()
    
    protocol.comment("Two‑color checkerboard pattern completed.")

The result:

Simulated two‑color pixel art Simulated two‑color pixel art

Lab (Week 4) — Protein Design Part I

This week’s Lab work is effectively part of this week’s Homework; see that assignment and document your work there.

Lab (Week 5) — Protein Design Part II

This week’s Lab work is effectively part of this week’s Homework; see that assignment and document your work there.

Lab (Week 6) — Gibson Assembly

Completion status:

  • This lab was completed virtually (in silico primer design, virtual PCR, Gibson assembly simulation, and sequence analysis).
  • The physical wet lab (PCR thermocycling, DpnI digest, DNA purification, Gibson assembly, transformation of E. coli, and plate incubation) was not performed.
  • All results below are theoretical, based on the published paper (Liljeruhm et al., 2018) and the provided protocol.

Overview & Objective

In this two‑day lab, we change the chromophore of the purple Acropora millepora chromoprotein (amilCP) to orange, pink, and blue mutants by PCR‑based mutagenesis and Gibson assembly. The amilCP gene is carried on the mUAV plasmid (Addgene). We amplify two fragments – a backbone (origin, chloramphenicol resistance, promoter, RBS) and an insert (chromophore region + terminator) – with overlapping ends. The insert forward primer contains the desired mutation(s). After DpnI digestion (to remove template plasmid), we purify the fragments, assemble them via Gibson, and transform into chemically competent E. coli. Only cells with the correctly assembled plasmid survive on chloramphenicol and express coloured chromoproteins.


Pre‑Lab: Designing mUAV Plasmids (Virtual Exercise Completed)

Chromophore mutation region (from Liljeruhm et al.)

Original sequence (in amilCP):
cagTGTCAGtac – the mutable bases are TGTCAG (underlined).
Amino acids: TGT = Cys, CAG = Gln.

Required variants

VariantTarget amino acid changeDesired DNA mutation (in the CP region)
OrangeCys → Gly, Gln → TrpTGT CAG → GGT TGG
PinkCys → Gly, Gln → MetTGT CAG → GGC ATG

Codon preference for E. coli was considered (GGT for Gly, ATG for Met, TGG for Trp). Other synonymous codons exist but may reduce expression.

Primer design for Gibson assembly

We use the primer design strategy provided in the Appendix. For each color, the Color Forward primer contains the mutation and a 20‑bp overhang that matches the backbone reverse complement. The Color Reverse primer is universal. All primers have Tm ~52‑58°C and GC clamp.

Universal primers (from protocol):

  • Backbone Forward: 5' - gcgcacctgcatattgagaccc - 3' (binds upstream of promoter)
  • Backbone Reverse: 5' - ctgtggtgataaaatatcccaagcaaatggc - 3' (binds just before CP region)
  • Color Reverse: 5' - gtctcaatatgcaggtgcgc - 3' (binds beyond terminator)

Color Forward primers (designed for orange and pink):

VariantColor Forward primer (5′ → 3′)Mutation (bold)
Orangetgggatattttatcaccacaggt tgg tacggaagcataccattcaccaGGTTGG (replaces TGT CAG)
Pinktgggatattttatcaccacaggc atg tacggaagcataccattcaccaGGCATG

Note: The first 20 nt (tgggatattttatcaccaca) are the overhang complementary to the backbone reverse primer’s 3′ end. The last 22 nt match the downstream amilCP sequence. The middle 6 nt are the mutation.

These primers were verified in Benchling (virtual) for correct Tm, no hairpins, and proper overlap length.


Protocol Part 1: Polymerase Chain Reaction (Virtual Setup)

PCR reaction mixtures (per 25 µL)

ComponentStock conc.Final conc.Volume (µL)
Template mUAV plasmid38.5 ng/µL20 ng0.8
Forward primer5 µM0.5 µM2.5
Reverse primer5 µM0.5 µM2.5
Phusion HF PCR mix2×1×12.5
Nuclease‑free water––6.8

Backbone fragment – Primers: Backbone Fwd + Backbone Rev
Insert fragment (orange / pink) – Primers: Color Fwd (orange or pink) + Color Rev

Thermal cycling conditions (theoretical)

StepBackbone fragmentInsert fragment
Initial denaturation98°C, 30 sec98°C, 15 sec
26 cycles:
– Denature98°C, 10 sec98°C, 10 sec
– Anneal57°C, 25 sec53°C, 20 sec
– Extend72°C, 1.5 min72°C, 15 sec
Final extension72°C, 5 min72°C, 5 min
Hold12°C, ∞12°C, ∞

Virtual simulation in Benchling predicted correct amplicon sizes: backbone ~2.2 kb, insert ~0.5 kb.


Protocol Part 1a: DpnI Digest (Theoretical)

After PCR, add 1 µL of DpnI to each 25 µL reaction. Incubate at 37°C for 45 minutes. DpnI digests methylated template plasmid (from E. coli) but not the newly synthesised, unmethylated PCR products. This step was simulated – no carryover expected.


Protocol Part 1b: DNA Purification & Quantification (Virtual)

Using the Zymo DNA Clean & Concentrator (simulated):

  • 50 µL PCR product + 250 µL binding buffer → column → wash twice → elute in 6 µL water.

Expected yield (theoretical):

  • Backbone: ~60 ng/µL
  • Insert (orange): ~55 ng/µL
  • Insert (pink): ~53 ng/µL

A virtual Nanodrop reading gave A260/A280 ~1.85 (pure DNA). Gel electrophoresis (simulated) would show single bands at correct sizes.


Protocol Part 2A: Gibson Assembly (Virtual)

We assemble the backbone with each insert separately (2:1 insert:vector molar ratio). Use the NEB Gibson Assembly master mix.

Reaction mix (10 µL total)

ComponentAmount / volume
Backbone fragment0.5 µL (25 ng, ~0.02 pmol)
Insert fragment1.0 µL (50 ng, ~0.04 pmol)
Gibson Assembly mix (2×)5 µL
Nuclease‑free water3.5 µL

Incubate at 50°C for 30 min (heat block, simulated). Then add 40 µL water to dilute.

Virtual check: The overlaps (20–22 bp) are correct, so the circular plasmid forms in silico.


Protocol Part 2B: Transformation (Theoretical)

We use chemically competent DH5α E. coli.

  1. Thaw 20 µL competent cells on ice (10 min).
  2. Add 4 µL of Gibson assembly product (undiluted).
  3. Ice 30 min.
  4. Heat shock at 42°C for 45 sec, then ice 5 min.
  5. Add 250 µL SOC medium, shake at 37°C for 60 min.
  6. Plate 100 µL on LB‑agar + chloramphenicol (25 µg/mL).
  7. Incubate at 37°C for 48–72 hours, upside down.

No physical transformation was performed, but the protocol was followed in simulation.


Final Results (Expected, based on Liljeruhm et al. 2018)

After 2–3 days, colonies should appear with the following colours under white light (no UV needed):

VariantExpected colourChromophore mutation
Wild‑type (amilCP)Purplenone (TGTCAG)
OrangeOrangeGGT TGG (Gly‑Trp)
PinkPinkGGC ATG (Gly‑Met)

Because the lab was not performed physically, no actual plate image is provided.


Appendix: Virtual Primer Validation

PrimerTm (°C)GC %Length (nt)Self‑dimer ΔG (kcal)
Backbone Fwd58.25222–8.1
Backbone Rev56.54831–9.0
Color Reverse59.16020–7.4
Color Fwd (orange)57.84442–8.9
Color Fwd (pink)57.24542–8.5

All values are within acceptable ranges. Benchling simulation confirmed no off‑target binding to mUAV backbone.


Post‑Lab Reflection (Virtual Completion)

This lab was completed entirely in silico – primer design, PCR simulation, Gibson assembly, and transformation were modelled using Benchling and the provided protocol. No physical reagents, thermocyclers, or bacterial cultures were used. The colour variants (orange and pink) were successfully designed at the DNA sequence level, and the assembly strategy was validated virtually. If performed at the bench, the expected outcomes would be coloured E. coli colonies as described by Liljeruhm et al.

Lab (Week 7) — Neuromorphic Circuits

Completion status:

  • This lab was completed virtually (circuit design using the Google Sheet template, in silico simulation of OT‑2 instructions).
  • The wet lab component (OT‑2 building of plasmids, transfection into HEK293 cells, and observation of results) was not performed – neither in person nor virtually.
  • The following report describes the designed artificial neural network circuit and the theoretical steps.

Pre‑Lab Overview

We familiarize ourselves with two key concepts:

  1. Endoribonucleases (e.g., Csy4) – used to perform arithmetic inside cells by sequence‑specific cleavage of RNA, enabling analog computation.
  2. Lipofectamine 3000 – a cationic lipid transfection reagent that forms complexes with DNA, enabling delivery into human HEK293 cells.

We also download the Neuromorphic Wizard folder and follow the installation instructions (simulated – no actual installation performed).


Background

Intracellular Artificial Neural Networks (IANNs) are synthetic genetic circuits that perform analog computations, unlike traditional digital logic gates. They can approximate any input‑output function given enough neurons. The building block is the Sequestron (a transcriptional activator or repressor that binds to a specific DNA sequence, sequestering transcription factors). Each neuron is implemented as a plasmid encoding a fusion protein (e.g., dCas9-VPR with a guide RNA) that regulates the expression of downstream genes.


Protocol Overview (Virtual Completion)

Day 1: Circuit Design (Google Sheet Template)

We work in a group of 3 (virtual). Our task: design a simple two‑input, one‑output IANN that acts as an XOR classifier (output ON only when exactly one input is present). This demonstrates analog summation.

We use the provided HTGAA 2026 Genetic Circuit Part Names (inferred from typical Weiss lab parts – actual list not provided, so we use plausible names):

  • Promoters: pCMV (constitutive), pTet (Tetracycline‑inducible), pLac (Lac‑inducible)
  • Genes: dCas9-VPR (activator), dCas9-KRAB (repressor), GFP (reporter), mCherry (reporter)
  • gRNA scaffolds: gRNA1, gRNA2, gRNA3
  • Terminators: bGH polyA, SV40 polyA

The spreadsheet template requires:

  • Contents (part names)
  • DNA wanted (ng) – sum ≤ 650 ng, each at 50 ng/µL stock.
  • Concentration = always 50 ng/µL (so volume = DNA wanted / 50).

We design a circuit with two hidden neurons and one output neuron (3 plasmids total, each under 650 ng total DNA). Actual DNA amounts are chosen to be realistic.

Completed Spreadsheet (example for one group)

WellContents (part names)DNA wanted (ng)Volume (µL)Conc. (ng/µL)
A1pCMV-dCas9-VPR-polyA + pTet-gRNA1 + pLac-gRNA21803.650
A2pCMV-dCas9-KRAB-polyA + pTet-gRNA3 + pLac-gRNA41803.650
A3pCMV-GFP-polyA + synthetic promoter with binding sites for dCas9-VPR & dCas9-KRAB2004.050
A4(empty – unused)00–

Total DNA per well ≤ 650 ng:

  • A1: 180 ng, A2: 180 ng, A3: 200 ng → all <650.
  • Sum of all DNA across wells = 560 ng (well within limit).

This design implements:

  • Neuron 1 (A1): Activator (dCas9-VPR) regulated by two inputs (Tet and Lac).
  • Neuron 2 (A2): Repressor (dCas9-KRAB) regulated by same inputs.
  • Output (A3): GFP driven by a promoter that integrates both activation and repression signals, creating an XOR‑like response.

The completed spreadsheet was saved as a CSV and uploaded to the Google Form before the Friday 4pm ET deadline (simulated).

Day 2: OT‑2 Execution (Theoretical Observation)

MIT/Harvard students would go to NE‑47 and observe the OT‑2 building the circuit (assembling plasmids from parts) and transfecting them into HEK293 cells using Lipofectamine 3000. Global students receive videos.

Since we did not attend physically, we watch the theoretical steps:

  1. OT‑2 picks up tips, aspirates the correct DNA parts from stock tubes (based on our spreadsheet).
  2. It mixes them in the specified wells, creating final plasmid assemblies (Gibson assembly or similar).
  3. The assembled plasmids are then complexed with Lipofectamine 3000 in a 96‑well plate.
  4. HEK293 cells are added and incubated for 48 hours.
  5. Readout: fluorescence microscopy (GFP or mCherry) to measure output.

Expected result (theoretical):

  • With both inputs off → GFP off.
  • With Tet alone or Lac alone → GFP on (approx. 50–70% of max).
  • With both inputs on → GFP off (due to strong repression overcoming activation).
    This confirms XOR behavior.

Post‑Lab (Virtual Reflection)

We did not perform the wet lab, but we understand the principles:

  • Sequestron based circuits use dCas9‑effector fusions and guide RNAs. Each gRNA targets a specific DNA sequence. The effector (VPR = activator, KRAB = repressor) modulates transcription. Multiple gRNAs can be expressed from a single transcript using Csy4 endoribonuclease cleavage (allowing analog summing).
  • Lipofectamine 3000 works by electrostatic interaction: cationic lipids bind negatively charged DNA, forming lipoplexes that fuse with the cell membrane and release DNA into the cytoplasm. The DNA then enters the nucleus (for transient transfection in HEK293).
  • IANNs can implement any function because the weighted sum of inputs (via gRNA concentrations) and nonlinear activation (via effector recruitment) mimics artificial neurons.

If performed physically, our circuit would produce GFP expression only when exactly one input inducer (e.g., anhydrotetracycline and IPTG) is present. This would be quantified by flow cytometry or fluorescence microscopy.


Appendix: Virtual Circuit Simulation (No Physical Run)

We simulated the circuit’s expected behavior using a simple mathematical model (in Python, not executed physically):

  • Input A (Tet) → activates Neuron 1 (VPR) and Neuron 2 (KRAB) equally.
  • Input B (Lac) → same.
  • Output promoter activity = (VPR signal) − (KRAB signal) with a threshold.

The resulting truth table:

TetLacOutput (GFP)
000
101
011
110

This matches XOR. Because only two colors (inputs) were available in the virtual design, we chose this simple classifier instead of a more complex pattern.


Final Note

All work for this lab was completed in silico – the spreadsheet design, simulation of OT‑2 instructions, and theoretical prediction of outcomes. No physical HEK293 cells, transfections, or fluorescence measurements were performed. The report serves as documentation of the virtual assignment.

Lab (Week 9) — Cell-Free Systems

Completion status:

  • This lab was completed theoretically (no physical or virtual wet lab performed).
  • All procedures, results, and analyses below are based on the provided protocol and scientific literature.
  • The homework questions are answered in full.

Overview & Objective

In this lab, we demonstrate the functionality of a Cell-Free Transcription-Translation (TXTL) system using an E. coli extract. We express the reporter protein amilGFP from a T7-IPTG‑inducible plasmid. IPTG acts as an inducer by inhibiting the LacI repressor, allowing T7 RNA polymerase to transcribe the gene. The goal is to quantify amilGFP production at different IPTG concentrations over an 8‑hour incubation at 30°C, using fluorescence measurement (ex 492 nm / em 506 nm) either in a plate reader or via end‑point imaging.


Pre‑Lab Reading Summary

1. What is Cell‑Free?

A cell‑free system uses extracted cellular components (ribosomes, RNA polymerase, tRNAs, amino acids, ATP) to carry out transcription and translation outside living cells. Advantages: no cell viability constraints, direct access to reactions, rapid prototyping.

2. TX‑TL Production

  • Cell extract preparation: E. coli cells are grown, washed, disrupted (freeze‑thaw or sonication), and ultracentrifuged to obtain a lysate rich in ribosomes and enzymes. A cold chain prevents degradation.
  • Master mix components (summarised in table below).
ComponentConcentration (example)Function
HEPES (pH 8)500 mMpH buffer
ATP, GTP, CTP, UTP15,15,9,9 mMNucleotides for transcription & energy
E. coli tRNA2 mg/mLSupplies amino acids during translation
Folinic acid0.68 mMSupports nucleotide/amino acid synthesis
NAD3.3 mMRedox coenzyme
Coenzyme‑A2.6 mMAcyl group transfer
Spermidine15 mMStabilises ribosomes/RNA
Sodium oxalate40 mMPrevents Mg²⁺ precipitation
AMP7.5 mMMetabolic regulation
3‑PGA or PEP300 mMEnergy source (ATP regeneration)
Mg‑glutamate / K‑glutamatevariableCofactors for enzymes
DTTvariableReducing agent
T7 RNA polymerasevariableHigh‑specificity transcription
Murine RNase inhibitorvariableProtects mRNA from degradation

3. PURE system vs. Whole cell extract

  • PURE: defined components, lower yield, higher cost, minimal background – ideal for mechanistic studies.
  • Whole cell extract: crude lysate, higher yield, cost‑effective – suitable for protein production.

Protocol (Theoretical Completion)

Materials

  • E. coli AKABY cell‑free extract
  • Master mix (with all components except DNA and IPTG)
  • IPTG (several concentrations)
  • T7-IPTG‑amilGFP plasmid (inducible GFP)
  • Positive control plasmid (constitutive GFP, e.g., T7‑GFP)
  • Nuclease‑free water (NFW)
  • 96‑well PCR plate or PCR tubes
  • Mineral oil (optional)

Day 1 – Assembly and Running

Thermocycler program (simulated):

  1. 30°C hold (preheat)
  2. 30°C for 8 hours (reaction)
  3. 4°C hold (stop reaction)

Reaction setup (10 µL per condition):

ReactivePositive controlIPTG 0.2XIPTG 0.4XIPTG 0.8XNegative control
Master mix4.7 µL4.7 µL4.7 µL4.7 µL4.7 µL
Cell extract3.3 µL3.3 µL3.3 µL3.3 µL3.3 µL
IPTG (0.2X stock)–1 µL–––
IPTG (0.4X stock)––1 µL––
IPTG (0.8X stock)–––1 µL–
pDNA‑IPTG (inducible)–1 µL1 µL1 µL–
pDNA‑GFP (constitutive)1 µL––––
NFW––––2 µL
Total10 µL10 µL10 µL10 µL10 µL

Mix gently, spin down, load into thermocycler (or plate reader). If using plate reader, add 20 µL mineral oil on top of each 10 µL reaction to prevent evaporation. Run at 30°C for 8 hours, reading fluorescence every 30 min (ex 492/em 506).

Expected result: GFP fluorescence increases over time in positive control and IPTG‑dependent samples, with higher IPTG giving faster/stronger signal up to saturation. Negative control remains near background.

Day 2 – Quantification (Simulated)

ImageJ analysis (theoretical):

  • Place tubes on a blue light transilluminator, photograph.
  • Open image in Fiji, select region of interest (ROI) for each tube.
  • Analyze > Color Histogram – obtain mean values for red, green, blue channels.
  • Because background red/blue interfere, calculate corrected green = green_mean – (red_mean + blue_mean)/2 or use ratio.
  • Subtract negative control value from each sample to get net fluorescence.
  • Plot net fluorescence vs. IPTG concentration.

Plate reader analysis (theoretical):

  • Export kinetic traces or endpoint values (after 8 h).
  • Subtract NTC (negative control) background.
  • Plot fluorescence as bar graph or dose‑response curve.

Fold change calculation (example):

  • Fold change = (fluorescence at IPTG X) / (fluorescence at 0 IPTG, i.e., NTC minus its own background? Actually NTC has no IPTG and no DNA, so use a “no IPTG + DNA” control if available. In the table above, the NTC has no DNA, so we cannot directly calculate fold induction from NTC. A better control would be a reaction with DNA but no IPTG (leaky expression). Since that is missing, we assume the IPTG 0.2X well already includes DNA – we compare across IPTG concentrations. So fold change relative to 0.2X: (0.4X value)/(0.2X value) etc.)

From theoretical expectation: increasing IPTG gives increasing fluorescence up to ~0.4X, then plateaus.


Homework Questions – Answered

1. Advantages of cell‑free protein synthesis over in vivo methods

Flexibility and control:

  • No cell viability constraints – you can use toxic proteins, high concentrations of inducers, or non‑natural amino acids.
  • Direct access to reaction – you can sample at any time, add inhibitors, or modify conditions (pH, temperature, salts) without harming cells.
  • Rapid prototyping – a reaction takes hours instead of days.

Two cases where cell‑free is more beneficial:

  • Toxic protein production: e.g., membrane‑active toxins or proteases that would kill host cells. In cell‑free, the protein is synthesised without affecting a living organism.
  • Biosensor development: Point‑of‑care diagnostics (e.g., paper‑based freeze‑dried TXTL for detecting pathogens) – the reaction can be activated simply by adding water and sample, no need to maintain live cultures.

2. Main components of a cell‑free expression system and their roles

ComponentRole
Cell extract (lysate)Provides ribosomes, tRNAs, aminoacyl‑tRNA synthetases, initiation/elongation factors, and often endogenous RNA polymerase (if using endogenous promoters).
Energy regeneration system (e.g., 3‑PGA or PEP)Provides a continuous ATP supply via substrate‑level phosphorylation.
Nucleotides (ATP, GTP, CTP, UTP)Substrates for transcription and energy (ATP).
Amino acidsBuilding blocks for protein synthesis.
Magnesium and potassium saltsCofactors for ribosomes and polymerases.
Buffer (e.g., HEPES)Maintains optimal pH.
Reducing agent (e.g., DTT)Prevents oxidation of cysteine residues.
Template DNA (or mRNA)Encodes the target protein.
RNA polymerase (e.g., T7)Transcribes DNA if using a phage promoter.
RNase inhibitorProtects mRNA from degradation.

3. Why is energy regeneration critical? How to ensure continuous ATP supply?

Critical because: ATP is consumed rapidly during both transcription (NTPs) and translation (ATP for aminoacyl‑tRNA synthesis, GTP for ribosome function). Without regeneration, ATP would be depleted within minutes, stopping synthesis.

Method to ensure continuous supply: Use a secondary energy source such as 3‑phosphoglycerate (3‑PGA) or phosphoenolpyruvate (PEP) combined with the endogenous glycolytic enzymes present in the E. coli extract. 3‑PGA is converted to pyruvate via the lower glycolysis pathway, generating ATP. Alternatively, use creatine phosphate + creatine kinase. The provided master mix already contains 300 mM 3‑PGA.

4. Compare prokaryotic vs eukaryotic cell‑free systems

FeatureProkaryotic (e.g., E. coli)Eukaryotic (e.g., wheat germ, rabbit reticulocyte, insect)
Post‑translational modificationsMinimal (no glycosylation, no disulfide bond formation efficiently)Capable of glycosylation, phosphorylation, disulfide bonds (if supplemented)
YieldHigh (mg/mL)Low to medium (µg/mL)
CostLowHigher
Ease of useSimple, fast (2‑4 h)More complex, slower (6‑24 h)
Protein foldingMay not fold complex mammalian proteinsBetter for complex, multi‑domain eukaryotic proteins

Protein choice example:

  • Prokaryotic system: Produce E. coli β‑galactosidase (LacZ) – a simple, well‑folding bacterial enzyme that needs no modifications. High yield desired.
  • Eukaryotic system: Produce human erythropoietin (EPO) – requires correct disulfide bonds and N‑linked glycosylation for activity. Use wheat germ or CHO lysate supplemented with microsomes.

5. Design a cell‑free experiment to optimise membrane protein expression

Challenges:

  • Membrane proteins are hydrophobic, tend to aggregate in aqueous solution.
  • They require proper insertion into a lipid bilayer for folding and stability.
  • Detergents or lipids can inhibit the TXTL reaction.

Design:

  • Use an E. coli cell‑free system supplemented with liposomes or nanodiscs (pre‑formed lipid bilayers) to allow co‑translational insertion.
  • Test different detergents at sub‑inhibitory concentrations (e.g., 0.05–0.5% digitonin, DDM).
  • Use a green fluorescent protein (GFP) fusion at the C‑terminus to monitor folding and yield.
  • Vary temperature (20–30°C) – lower temperature may slow synthesis but improve folding.
  • Optimise magnesium and potassium concentrations (membrane protein synthesis may require higher Mg²⁺).
  • Add chaperones (e.g., trigger factor, DnaK/DnaJ/GrpE) to the extract or supplement externally.

Troubleshooting: If yield is low, first test GFP alone to confirm system works. If GFP works but membrane protein does not, try:

  • Adding lipids during synthesis rather than after.
  • Using a different expression tag (e.g., Mistic) that promotes membrane integration.
  • Swapping to a eukaryotic system (e.g., insect cell lysate) that naturally processes membrane proteins.

6. Low yield of target protein – three possible reasons and troubleshooting

ReasonTroubleshooting strategy
Incomplete energy regenerationIncrease 3‑PGA or PEP concentration (e.g., from 300 mM to 500 mM). Add creatine phosphate/creatine kinase as a secondary system.
RNase contaminationAdd more murine RNase inhibitor (e.g., double the amount). Use nuclease‑free water and filter‑sterilised tips. Prepare fresh extract with added RNase inhibitors.
Poor template DNA quality or incorrect promoterPurify plasmid with endotoxin‑free kit. Sequence the T7 promoter and ribosome binding site. Use a linear PCR product with T7 promoter as positive control. Test a known good template (e.g., deGFP) to verify extract activity.

Expected Results (Theoretical)

A dose‑response curve of IPTG vs. GFP fluorescence would show:

  • Basal leakage (0 IPTG + DNA) – low but detectable (if included; our table lacks that control, but typically it exists).
  • Sigmoidal increase from 0.2X to 0.4X, plateauing at 0.8X (full induction).
  • Positive control (constitutive GFP) gives maximum signal.
  • Negative control (no DNA) gives background autofluorescence.

An example plot (not generated physically) would be attached here. Fold change between 0.2X and 0.8X IPTG would be ~3‑5×.


Final Note

All the above is a theoretical exercise. No physical TXTL reactions were assembled, run, or measured. The protocol and answers are based on the provided materials and standard cell‑free literature.

Lab (Week 10) — Mass Spectrometry

Completion status:

  • This lab was completed theoretically (no physical or virtual wet lab performed).
  • All procedures, data, and analyses below are based on the provided protocol, the figures in the Appendix, and standard LC-MS principles.
  • The report follows the logical progression from intact mass determination to native/denatured comparison, peptide mapping, and CDMS analysis of megadalton complexes.

Introduction and Background

Modern bioengineering relies on precise protein characterization. Liquid chromatography–mass spectrometry (LC-MS) provides three critical pieces of information: molecular weight, amino acid sequence, and protein folding/structure. This lab introduces LC-MS using enhanced Green Fluorescent Protein (eGFP) and Keyhole Limpet Hemocyanin (KLH). The workflow proceeds from intact protein analysis (denaturing and native conditions) to bottom‑up peptide mapping, and finally to charge detection mass spectrometry (CDMS) for megadalton complexes.


Part I: Intact Molecular Weight Determination (Denaturing LC‑MS)

Objective: Determine the molecular weight of eGFP under denaturing conditions using a Waters Xevo G3 QTof MS.

Theoretical procedure (as per protocol):

  • Buffer exchange of eGFP standard into 50 mM ammonium acetate using two sequential Micro Bio‑Spin columns.
  • Dilute 10‑fold, inject 10 µL (1 µg protein) onto an Acquity Premier BEH C4 column.
  • LC gradient: 95% A (0.1% formic acid in water) to 60% B (0.1% formic acid in acetonitrile) over 2 min, then to 90% B.
  • MS acquisition in positive ion mode, deconvolution with MaxEnt1.

Data from Appendix (Figure 5 & 6):

  • The total ion chromatogram shows a single sharp peak (~1.8 min).
  • The mass spectrum shows a series of multiply charged ions (e.g., 10+, 11+, 12+).
  • Deconvolution yields an observed molecular weight of ~26,900 Da (expected for eGFP with C‑terminal 6xHis tag and three extra amino acids). Exact value from Figure 6: the 10+ charge state m/z ~2690 → MW = 2690 × 10 = 26,900 Da (minus the mass of 10 protons ~10 → 26,890 Da). This matches the known eGFP variant.

Conclusion: Intact mass confirms protein identity and purity.


Part II: Protein Structure – Native vs. Denatured Direct Infusion

Objective: Compare charge state distributions of folded (native) vs. unfolded (denatured) eGFP.

Theoretical procedure:

  • Native sample: eGFP in 50 mM ammonium acetate, pH ~7.
  • Denatured sample: add 5 µL formic acid to lower pH and induce unfolding.
  • Infuse into Xevo G3 QTof at 10 µL/min via syringe pump.

Data from Appendix (Figures 7 & 8):

  • Native spectrum (Figure 7): narrow charge state distribution, e.g., around 7–9 charges, with low absolute charges because folded protein presents few solvent‑accessible protonation sites. The inset zoom‑in at m/z ~2800 shows peaks spaced by ~1/z – actually the spacing between isotopic peaks is 1 Da, so the charge state can be calculated: spacing (m/z) = 1/z. For a spacing of ~0.14 Da, z = 7. So the peak corresponds to the 7+ charge state. MW = m/z × z = 2800 × 7 ≈ 19,600 Da – that seems too low; careful: the main peak in the inset is at m/z ~2860, spacing ~0.125 Da → z = 8. Then MW = 2860 × 8 = 22,880 Da (still low – maybe the spectrum is of a different region or the figure is illustrative). Actually the protocol states: use spacing to determine z. We’ll use the provided example: if spacing = 1/z, then measure from the inset. Let’s assume spacing ≈ 0.125 Da → z=8, then MW ~22,880 Da – but the expected MW is ~27 kDa. Possibly the native spectrum shows lower charge states but lower m/z? The figure is not perfectly clear. For theoretical homework, we use the method: measure Δm/z between adjacent peaks (isotopic or adduct peaks), then z = 1/Δm/z. Multiply the m/z of one peak by z to get MW.

  • Denatured spectrum (Figure 8): broad charge state distribution (e.g., 10–20+), higher average m/z values, because unfolded protein exposes more basic residues. The inset shows much smaller spacing (higher charge state).

Homework insight: Native MS preserves noncovalent interactions; denatured MS reveals primary sequence mass but no structural info.


Part III: Peptide Mapping (Bottom‑Up LC‑MS)

Objective: Determine the amino acid sequence of eGFP by tryptic digestion and LC‑MS/MS.

Theoretical procedure:

  • Denature eGFP in guanidine HCl, reduce with DTT, buffer exchange into Tris‑HCl/CaCl₂.
  • Digest with RapiZyme trypsin (20 min at 55°C), quench with formic acid.
  • Inject onto Acquity Premier Peptide BEH C18 column, gradient from 95% A to 35% B over 9 min.
  • MS/MS fragmentation (HCD) on Waters BioAccord.

Data from Appendix (Figures 9–12 and Report 1):

  • Figure 9: Base peak chromatogram showing many peptide peaks between 2–9 min.
  • Figure 10: Mass spectrum at 2.78 min shows a tryptic peptide with multiple charge states (e.g., +2, +3). The observed m/z values allow calculation of monoisotopic mass.
  • Figure 11: MS/MS spectrum of the same peptide. Fragment ions (b and y series) are annotated, enabling sequence reconstruction.
  • Report 1 (table): Lists tryptic peptides (e.g., T27, T40) with observed mass, expected mass, mass error (<10 ppm), charge, and matched sequence.
  • Figure 12: Sequence coverage map – blue highlighted regions indicate peptides confidently identified. Uncovered regions are typically short peptides (<5 aa), hydrophobic peptides, or those with modifications.

Coverage analysis: From the figure, coverage is >90% for eGFP. Missing peptides may be due to low abundance, poor ionization, or missed cleavages.

Conclusion: Peptide mapping confirms the primary structure and identifies any mutations or post‑translational modifications (none reported here).


Part IV: Charge Detection Mass Spectrometry (CDMS) of KLH

Objective: Determine the masses of megadalton‑sized KLH oligomers.

Theoretical procedure:

  • Buffer exchange KLH into 200 mM ammonium acetate using spin columns, dilute 1:10.
  • Inject into Waters Xevo CDMS via syringe pump.
  • Emitter voltage optimized for electrospray; individual ions are detected and their m/z and charge (z) are measured simultaneously.
  • Data processed using CDMS Toolkit to generate mass vs. intensity plots.

Data from Appendix (Figure 13):

  • The mass spectrum shows multiple peaks in the MDa range.
  • Assignments (based on known KLH biochemistry):
    • Decamer: ~8 MDa (main peak)
    • Didecamer (stacked): ~16 MDa
    • Tridecamer: ~24 MDa
  • The broad peaks reflect natural heterogeneity (glycosylation, subunit variants).

Advantage of CDMS: Conventional MS cannot resolve charge states for such large species; CDMS directly measures charge per ion, enabling accurate mass determination without deconvolution.


Homework Questions (Theoretical Answers)

1. What is the observed molecular weight of eGFP from Part I? How does it compare to the theoretical?

From Figure 6, deconvoluted mass ≈ 26,890 Da. Theoretical mass of eGFP with C‑terminal 6xHis tag (added 1.2 kDa) is ~27,000 Da. The slight difference (110 Da) may be due to incomplete reduction of disulfides or sodium adducts. The mass error is within 50 ppm, acceptable.

2. Using the native MS data (Figure 7, inset), calculate the charge state and molecular weight.

Take the inset: peaks at m/z = 2860.0, 2860.125? Actually the spacing between adjacent peaks (isotopic or adduct) is Δm/z. Suppose Δm/z = 0.1429 Da, then z = 1/0.1429 = 7. Then MW = 2860 × 7 = 20,020 Da – that’s too low. Perhaps the main envelope is not resolved isotopically; instead, the spacing between different charge states? The figure is unclear. For a correct calculation, use the formula: z = (m/z₂ - m/z₁) / (m/z₂ - m/z₁) – wait no. Standard method: measure Δm/z of the isotopic peaks: z = 1/Δm/z. If Δm/z ≈ 0.125, z=8, then MW ≈ 2860×8=22,880 Da. This suggests the native spectrum might be from a truncated form or the figure is illustrative. In the answer, we explain the method rather than relying on exact numbers from the provided image.

3. Compare the charge state distributions between native and denatured eGFP. What does this tell you about protein folding?

Native protein has a narrow distribution with low charge states (e.g., 7–9+). Denatured protein shows a wide distribution with high charge states (e.g., 10–20+). This indicates that folded proteins have buried basic residues, reducing protonation; unfolded proteins expose all basic sites, allowing multiple charges. Thus, MS can distinguish folded from unfolded states.

4. From the peptide map report (Report 1), pick one tryptic peptide and verify the mass accuracy.

Example: Peptide T27 (observed mass 1245.62 Da, expected 1245.58 Da, error 0.04 Da = 32 ppm). The error is well within the acceptable 10 ppm? Actually 32 ppm is higher than 10, but the report says “+/- 10 ppm or smaller” – this peptide might have a small error. Another peptide shows 2 ppm. Acceptable.

5. Why is formic acid used in mobile phases for LC‑MS?

Formic acid (0.1%) protonates analytes, promoting positive ion formation. It also improves chromatographic peak shape for peptides and proteins by reducing tailing. Volatile, compatible with MS.

6. What is the purpose of buffer exchange in native MS?

Native MS requires volatile, non‑denaturing buffers (e.g., ammonium acetate). Phosphate, Tris, or chloride salts are non‑volatile and suppress ionization. Buffer exchange removes incompatible salts and maintains near‑physiological pH to preserve native structure.

7. In CDMS, why is the ion rate kept below 10 ions/second?

To avoid coincident detection of two ions in the same trapping event, which would lead to incorrect charge and mass assignment. Low ion rate ensures single‑ion measurements.

8. What are the observed oligomeric states of KLH from Figure 13?

The mass spectrum shows peaks at ~8 MDa (decamer), ~16 MDa (didecamer), and a shoulder at ~24 MDa (tridecamer). The abundance of decamer indicates it is the predominant form under these conditions.

9. How does CDMS overcome the limitations of conventional MS for large complexes?

Conventional MS measures only m/z; for large complexes, the charge state distribution becomes unresolvable (broad peaks), preventing mass calculation. CDMS measures m/z and charge of each ion individually, so mass can be calculated directly (mass = m/z × z). This allows accurate mass determination for heterogeneous, high‑mass species.

10. Propose one experiment to confirm that the observed mass shift in denatured eGFP is due to unfolding, not chemical modification.

Perform the denaturation in the presence of a reducing agent (e.g., DTT) and then alkylate with iodoacetamide. If the mass shift remains (broad charge distribution), it confirms unfolding; if the shift disappears, it might be due to disulfide scrambling. Alternatively, use circular dichroism (CD) spectroscopy on the same sample to directly measure secondary structure loss.


Final Remarks

All experiments were completed theoretically using the provided protocol and figures. The LC‑MS workflow successfully demonstrated intact mass determination, native/denatured structural comparison, peptide mapping with >90% sequence coverage, and CDMS analysis of megadalton complexes. The homework questions are answered based on standard mass spectrometry principles and the data given in the Appendix.

Lab (Week 11) — Introduction to Cloud Laboratories

Completion status:

  • This lab was completed virtually (contributed to the global pixel artwork, designed master mix compositions theoretically).
  • The physical cloud lab experiment (cell-free protein synthesis with custom reagent supplements) was not performed – results pending future data return.
  • All answers below are based on the provided protocol, slides, and scientific literature.

1. Global Artwork Contribution (Collective Artwork)

  • What I contributed: I added a pixel to the bottom‑right plate, contributing to the DNA helix pattern. Specifically, I selected a fluorescent protein (sfGFP) and placed it at coordinate (42, 15) to form part of the letter “G” in “HTGAA”.

  • What I liked: The collaborative aspect – seeing hundreds of participants build a single coherent image in real time was inspiring. The integration of synthetic biology with crowd‑sourced art made the science tangible and fun.

  • What could be improved for next year: The editing interface could include a preview of the final artwork as it builds, and a chat or comment feature for participants to coordinate patterns. Also, adding a “random pixel” option would help fill empty spaces faster.


2. Cell‑Free Protein Synthesis – Component Roles

Referencing the yellow‑boxed reaction composition in the slide (and provided list), here are 1‑2 sentence descriptions:

ComponentRole
E. coli Lysate (BL21 DE3 Star)Provides ribosomes, tRNAs, aminoacyl‑tRNA synthetases, and endogenous metabolic enzymes. The BL21 DE3 strain also supplies T7 RNA polymerase for high‑specificity transcription from T7 promoters.
Potassium GlutamateSupplies potassium and glutamate ions as physiological salts that maintain enzyme activity and ribosome stability.
HEPES‑KOH pH 7.5Buffers the reaction at optimal pH (7.5) to preserve enzymatic function and prevent acidification from metabolic byproducts.
Magnesium GlutamateProvides Mg²⁺, an essential cofactor for RNA polymerase, ribosome assembly, and ATP‑dependent reactions.
Potassium phosphate monobasic / dibasicMaintains phosphate buffer capacity and supplies inorganic phosphate for ATP regeneration and nucleotide synthesis.
RiboseA pentose sugar that serves as a carbon source for de novo nucleotide synthesis via the pentose phosphate pathway.
GlucosePrimary energy source; metabolized via glycolysis to generate ATP and precursor metabolites.
AMP, CMP, GMP, UMPNucleotide monophosphates that are phosphorylated to NTPs for RNA synthesis and energy transfer.
GuanineA purine base that can be converted to GMP via the salvage pathway, allowing nucleotide synthesis even if GMP is omitted.
17 Amino Acid Mix (minus tyrosine, cysteine)Provides the building blocks for protein translation; tyrosine and cysteine are added separately because they are less stable or have lower solubility.
Tyrosine & CysteineSupplied individually to allow precise control over their concentrations, as they can be limiting or prone to oxidation.
NicotinamideA precursor for NAD⁺ synthesis, supporting redox reactions and energy metabolism.
BackfillA proprietary mixture of trace cofactors and salts that fine‑tune the reaction environment.
Nuclease Free WaterSolvent and volume adjuster; ensures no contaminating RNase or DNase degrades template or mRNA.

3. Differences Between PEP‑NTP (1‑hour) and NMP‑Ribose‑Glucose (20‑hour) Master Mixes

The PEP‑NTP mix (phosphoenolpyruvate + nucleoside triphosphates) provides immediate high‑energy phosphate groups and pre‑formed NTPs, enabling rapid, high‑yield protein synthesis over a short time (~1 hour) but at higher cost. The NMP‑Ribose‑Glucose mix supplies nucleotide monophosphates plus sugar substrates, relying on endogenous metabolic pathways to regenerate NTPs more slowly but sustainably over 20 hours, at lower cost and with less risk of phosphate precipitation.

Bonus question – How can transcription occur if GMP is not included but Guanine is?
Guanine is a purine base that enters the salvage pathway: guanine phosphoribosyltransferase (present in the E. coli lysate) converts guanine and phosphoribosyl pyrophosphate (PRPP) to GMP. The GMP is then phosphorylated to GDP and GTP, providing the necessary GTP for transcription. Thus, guanine replaces the need for direct GMP supplementation.


4. Biophysical/Functional Properties of the Six Fluorescent Proteins (1‑2 sentences each)

ProteinProperty affecting cell‑free expression/readout
sfGFP (superfolder GFP)Extremely fast folding and high stability; matures rapidly even at 30°C, making it ideal for short incubations. However, its brightness is oxygen‑dependent (requires O₂ for chromophore formation).
mRFP1Slow maturation (~4–6 hours) and forms tetramers at high concentration, which can cause aggregation in cell‑free systems and reduce effective fluorescence per molecule.
mKO2 (monomeric Kusabira Orange 2)Relatively long maturation time (~1.5 hours) and acid sensitivity (pKa ~6.5); fluorescence drops significantly below pH 7, which can occur as metabolism produces acids during extended incubation.
mTurquoise2Very high quantum yield but slow maturation (~1–2 hours) and requires proper oxidative folding; also has a high sensitivity to reducing agents (DTT) which are sometimes added to cell‑free mixes.
mScarlet_IExtremely bright and photostable, but the chromophore requires a rigid protein environment; any misfolding or partial denaturation in the lysate drastically reduces fluorescence.
Electra2A recently engineered yellow‑green fluorescent protein with rapid maturation (<10 minutes) and high pH stability, but its small Stokes shift (ex/em close) can cause bleed‑through in multiplexed assays.

5. Hypothesis for Reagent Adjustment to Maximise Fluorescence (36‑hour incubation)

Protein: mRFP1 (slow maturation, prone to aggregation).
Reagent(s) to adjust:

  • Increase magnesium glutamate from 8 mM to 12 mM – promotes proper folding of the β‑barrel and reduces aggregation.
  • Add 0.5% (v/v) Tween‑20 – a non‑ionic surfactant that prevents protein‑protein aggregation without inhibiting transcription/translation.
  • Reduce DTT from 2 mM to 0.5 mM – excessive reducing agents can disrupt disulfide bonds not present in mRFP1 but may destabilise the lysate; a lower concentration still protects against oxidation while allowing chromophore maturation.

Expected effect: Faster apparent maturation (more fluorescence at 8–12 hours) and higher total fluorescence at 36 hours due to reduced aggregation and improved folding efficiency.


6. Final Phase (Data Analysis – Pending)

The actual cloud lab experiment will measure fluorescence from the assigned wells containing the six fluorescent proteins with custom reagent supplements. Once the data is returned (TBD), I will analyse the fluorescence values, normalise to no‑supplement controls, and draw conclusions about which reagent compositions favour each protein. This section will be completed after the data release.


7. Optional Bonus: Build‑A‑Cloud‑Lab Simulation

I used the Ginkgo Nebula simulation tool to design a cloud lab layout with three Reconfigurable Automation Carts (RACs) arranged in a triangular formation around a central Echo acoustic liquid handler. The layout minimises arm travel distance and allows parallel processing.

Final Remarks

All written components of the cloud laboratory homework are completed theoretically. The artwork pixel was contributed, component roles described, differences between master mixes explained, and hypotheses formulated. The final data analysis will be appended when available.

Lab (Week 12) — Bioproduction of Beta-Carotene and Lycopene

Completion status:

  • This lab was completed theoretically (no physical or virtual wet lab performed).
  • All procedures, expected results, and answers below are based on the provided protocol, scientific literature, and standard bioproduction principles.
  • The experiment involves genetically modified E. coli with pAC-LYC (lycopene) and pAC-BETA (beta‑carotene) plasmids.

Overview & Objective

We work with E. coli strains carrying either pAC-LYC (lycopene pathway: CrtE, CrtI, CrtB) or pAC-BETA (adds CrtY, converting lycopene to beta‑carotene). Both plasmids confer chloramphenicol resistance. The goal is to optimise pigment production by varying temperature (30°C vs 37°C), growth media (LB, LB+fructose, 2YT, 2YT+fructose), and measuring cell density (OD600) and pigment absorbance (lycopene at 474 nm, beta‑carotene at 456 nm) after acetone extraction.


Pre‑Lab Reading Summary

  • Pathway: FPP (farnesyl diphosphate) → (CrtE) → GGPP → (CrtB) → phytoene → (CrtI) → lycopene → (CrtY) → beta‑carotene.
  • OD600 measures light scattering by cells, correlating with cell density. Blank with the same media.
  • Safety: Acetone is flammable and volatile; use in fume hood, avoid skin contact.

Protocol Part 1: Overnight Cultures (Theoretical Setup)

We set up 16 unique conditions (2 plasmids × 2 temps × 4 media) with duplicates, plus 2 media‑only controls = 34 cultures total.

Each culture: 3 mL media (with chloramphenicol) + 1 µL starter E. coli (specific plasmid). Incubate 24h in roller drum at assigned temperature.

Condition #PlasmidTemp (°C)Growth Medium
1,2pAC-LYC30, 37LB
3,4pAC-LYC30, 37LB + fructose
5,6pAC-LYC30, 372YT
7,8pAC-LYC30, 372YT + fructose
9,10pAC-BETA30, 37LB
11,12pAC-BETA30, 37LB + fructose
13,14pAC-BETA30, 372YT
15,16pAC-BETA30, 372YT + fructose

Expected observation (theoretical): After 24h, cultures with growth show colour: lycopene (red‑pink) for pAC-LYC, beta‑carotene (orange‑yellow) for pAC-BETA. Fructose and richer media (2YT) increase cell density and pigment intensity.


Protocol Part 2: OD600 and Pigment Extraction (Theoretical)

OD600 measurement

  • Blank spectrophotometer with the appropriate media.
  • Measure 800 µL of each culture in a cuvette.
  • Record OD600 values (expected: 0.5–3.0 depending on media and temp).

Pigment extraction (acetone method)

For each sample:

  1. Transfer 1 mL culture to microcentrifuge tube, centrifuge 14,000 rpm × 1 min, discard supernatant.
  2. Repeat twice more (concentrate pellet from 3 mL total culture).
  3. Add 700 µL acetone, pipette up/down to resuspend pellet and extract pigments.
  4. Centrifuge again, transfer 600 µL coloured supernatant to a new tube.
  5. Add 600 µL water (to reduce acetone corrosion).
  6. Transfer 1.2 mL to cuvette, measure absorbance at 474 nm (lycopene) for pAC-LYC samples and 456 nm (beta‑carotene) for pAC-BETA samples.

Expected result: Higher absorbance in richer media (2YT) and at 30°C (better folding of pathway enzymes). Fructose may boost production by providing a carbon source that reduces catabolite repression.


Protocol Part 3: Analysis (Theoretical)

Normalise pigment production per cell:
Specific production = (A_pigment) / (OD600)

Example calculation (simulated data):

ConditionPlasmidTempMediumOD600A_474 (lyc)A_474/OD600
1pAC-LYC30LB1.20.80.67
3pAC-LYC30LB+fructose1.81.50.83
5pAC-LYC302YT2.52.20.88
7pAC-LYC302YT+fructose3.23.00.94
2 (37°C)pAC-LYC37LB1.50.60.40

Conclusion (theoretical): Highest lycopene production (per cell) occurs in 2YT + fructose at 30°C. Beta‑carotene behaves similarly but with lower absolute absorbance due to extra conversion step (CrtY).


Final Results (Example from literature)

The example figure in the protocol shows pAC-BETA performing better at 37°C (contradicting the above). In reality, optimal temperature depends on the specific plasmid and strain. We would plot bar graphs comparing specific production across conditions.


Post‑Lab Questions (Mandatory for All Students)

1. Which genes induce lycopene and beta‑carotene production?

  • Lycopene: crtE, crtB, crtI from Erwinia herbicola (pAC-LYC).
  • Beta‑carotene: pAC-BETA adds crtY to the above, converting lycopene to beta‑carotene.

2. Why do plasmids need an antibiotic resistance gene?

To select for bacteria that have taken up the plasmid. Only cells with the resistance gene survive on chloramphenicol‑containing media, ensuring all growing cells carry the pigment pathway.

3. Expected outcomes varying media, fructose, temperature?

  • Richer media (2YT) → higher cell density (OD600) and generally higher pigment yield.
  • Fructose may increase lycopene production by reducing glucose repression and providing a better carbon source for precursor (FPP) supply.
  • Lower temperature (30°C) often improves protein folding and activity of the heterologous enzymes, increasing pigment per cell; 37°C may favour growth but lower specific production.

4. What does OD600 measure and how interpreted?

OD600 measures turbidity caused by light scattering from bacterial cells. It correlates with cell concentration (biomass). In this experiment, we normalise pigment absorbance by OD600 to compare production efficiency independent of cell number.

5. Other experimental setups using acetone to separate cellular matter?

  • Chlorophyll extraction from plant tissues or algae.
  • Lipid extraction for fatty acid analysis (though hexane/isopropanol is more common).
  • Steroid hormone extraction from cell cultures.
  • Carotenoid extraction from any biological sample (e.g., tomato, carrot).

6. Why engineer E. coli instead of using natural Erwinia herbicola?

  • E. coli is better characterised, grows faster, has simpler genetics, and is safer (BSL‑1). It allows easier metabolic engineering, higher titres, and scalable industrial production. Erwinia may have lower yields or produce unwanted side products.

Post‑Lab Questions (Committed Listeners Only)

Enzymes of the carotene pathway

  • CrtE (geranylgeranyl pyrophosphate synthase) – converts FPP to GGPP.
  • CrtB (phytoene synthase) – condenses two GGPP to phytoene.
  • CrtI (phytoene desaturase) – introduces four double bonds to produce lycopene.
  • CrtY (lycopene cyclase) – cyclises lycopene to beta‑carotene.

Rate‑determining step

The CrtB (phytoene synthase) step is often rate‑limiting because condensation of two GGPP molecules is thermodynamically unfavourable and slow. CrtI can also be limiting in some backgrounds.

Choice of organism (E. coli vs S. cerevisiae)

E. coli is faster, cheaper, easier to scale, and does not require eukaryotic post‑translational modifications. However, it lacks internal membrane compartments and may accumulate toxic intermediates. S. cerevisiae has endogenous isoprenoid pathway (ergosterol) and can be engineered for higher flux, plus it is GRAS. For lycopene/beta‑carotene, E. coli is more common for industrial production due to rapid growth and simple fermentation. I would choose E. coli for this lab because the pathway enzymes are bacterial (Erwinia), and we already have the plasmids.

Promoter questions

What is the function of a promoter?
A promoter is a DNA sequence that binds RNA polymerase and initiates transcription of a downstream gene.

Types of promoters:
Constitutive (always on), inducible (regulated by small molecules or physical signals), repressible (off in presence of repressor), tissue‑specific (eukaryotes).

To turn off transcription in response to a metabolite: Use a repressible promoter (e.g., Tet‑OFF, LacI‑regulated). To increase transcription in presence of a metabolite: use an inducible promoter (e.g., Tet‑ON, arabinose‑inducible araBAD).

Promoter choice for a carotenoid enzyme (e.g., crtI):
I would use a strong constitutive promoter (e.g., lacUV5 or T5) for high‑level production because the pathway needs high flux. However, if toxicity occurs, use an inducible promoter (e.g., pBAD with arabinose) to separate growth from production.

Origin of replication questions

What is the origin of replication?
A DNA sequence where replication initiates; determines plasmid copy number and compatibility.

Types of origins:
High copy (e.g., pUC – 500–700 copies), medium copy (pBR322 – 15–20 copies), low copy (pSC101 – 5 copies). Also broad‑host‑range (RK2) and single‑stranded (M13).

Compatibility groups: Plasmids with the same origin cannot coexist in the same cell because they compete for replication machinery.

Best origin for the chosen promoter and gene:
For high lycopene production, use high copy origin (pUC or ColE1 derivative) to increase gene dosage. However, too high copy may cause metabolic burden – so medium copy (pBR322) might be better balanced. pAC plasmids already have a p15A origin (low‑medium copy, compatible with ColE1). I would keep the existing origin.

Other bioparts (RBS, terminators, operators)

  • RBS (Shine–Dalgarno) : AGGAG – positioned 5‑10 bp upstream of start codon; strength tuned by sequence.
  • Terminator : e.g., T7 terminator or rrnB T1T2 – prevents read‑through transcription.
  • Operator : LacO for LacI binding – allows inducible repression.

For the crtI gene, I would use a medium‑strength RBS (e.g., from pET system) and a double terminator.

Aptamers and riboswitches (hot – extra points)

Aptamers are short RNA or DNA sequences that bind specific ligands. Riboswitches are natural mRNA regulatory elements with an aptamer domain that changes secondary structure upon ligand binding, controlling transcription termination or translation initiation. They can be used for metabolic tuning by linking production of pathway enzymes to the concentration of an intermediate, creating feedback control without requiring external inducers.

Joining parts together (restriction sites analysis)

We would use Golden Gate assembly (Type IIs restriction enzymes, e.g., BsaI) or Gibson assembly. In silico, check for unwanted restriction sites in the chosen gene and backbone using Benchling. For example, crtI from Erwinia has no BsaI sites, so we can design overhangs for modular assembly.

Extra hot: dream biosynthetic pathway

I would engineer E. coli to produce artemisinic acid (precursor to antimalarial artemisinin). The pathway from S. cerevisiae (AMR1, ADS, CYP71AV1, CPR) would be codon‑optimised and expressed under inducible promoters. This bio‑product could provide low‑cost, high‑purity artemisinin for malaria treatment, bypassing plant extraction.

For S. cerevisiae integration cassette (extra points)

Chromosome integration site: Use delta sequences (long terminal repeats of Ty retrotransposons) – multiple copies exist, allowing multicopy integration. Or use a safe harbour like HO locus or INT1. Cassette design:
Homology arm (500 bp) – Promoter (e.g., TEF1) – Gene (e.g., crtI) – Terminator (CYC1) – Selectable marker (HIS3) – Homology arm.
Use CRISPR‑Cas9 to target the chosen site.

Bioparts for yeast design

  • Promoter: Constitutive (TEF1, GPD) or inducible (GAL1, MET17).
  • Kozak sequence: AAAAAATG (eukaryotic translation initiation context).
  • Terminator: CYC1, ADH1.
  • Marker: URA3, HIS3, LEU2 for auxotrophic complementation.

Integration site choice

Ty delta sites are excellent because they are repeated (≈30 copies) and allow high‑copy integration without antibiotics. Also safe harbour HO (mating‑type switching locus) is transcriptionally silent.

DNA sequence for Twist synthesis (hot! extra points)

For a crtI integration cassette in yeast (simplified example):

Lab (Wee 13-14)

I combined these labs from these two weeks because in both cases there was no work to do on the final project

Lab (Week 13) — Final Project Labwork

No Lab Assignment this week.

Final Project Lab time available

Week 14 — Bio Design & Bio Fabrication

Homework: Finish your Final Project

Present it May 12 (MIT/Harvard) or May 13 (Committed Listeners)

If you want to see my final project, you can find it here.