Lab (Week 6) — Gibson Assembly

Completion status:

  • This lab was completed virtually (in silico primer design, virtual PCR, Gibson assembly simulation, and sequence analysis).
  • The physical wet lab (PCR thermocycling, DpnI digest, DNA purification, Gibson assembly, transformation of E. coli, and plate incubation) was not performed.
  • All results below are theoretical, based on the published paper (Liljeruhm et al., 2018) and the provided protocol.

Overview & Objective

In this two‑day lab, we change the chromophore of the purple Acropora millepora chromoprotein (amilCP) to orange, pink, and blue mutants by PCR‑based mutagenesis and Gibson assembly. The amilCP gene is carried on the mUAV plasmid (Addgene). We amplify two fragments – a backbone (origin, chloramphenicol resistance, promoter, RBS) and an insert (chromophore region + terminator) – with overlapping ends. The insert forward primer contains the desired mutation(s). After DpnI digestion (to remove template plasmid), we purify the fragments, assemble them via Gibson, and transform into chemically competent E. coli. Only cells with the correctly assembled plasmid survive on chloramphenicol and express coloured chromoproteins.


Pre‑Lab: Designing mUAV Plasmids (Virtual Exercise Completed)

Chromophore mutation region (from Liljeruhm et al.)

Original sequence (in amilCP):
cagTGTCAGtac – the mutable bases are TGTCAG (underlined).
Amino acids: TGT = Cys, CAG = Gln.

Required variants

VariantTarget amino acid changeDesired DNA mutation (in the CP region)
OrangeCys → Gly, Gln → TrpTGT CAG → GGT TGG
PinkCys → Gly, Gln → MetTGT CAG → GGC ATG

Codon preference for E. coli was considered (GGT for Gly, ATG for Met, TGG for Trp). Other synonymous codons exist but may reduce expression.

Primer design for Gibson assembly

We use the primer design strategy provided in the Appendix. For each color, the Color Forward primer contains the mutation and a 20‑bp overhang that matches the backbone reverse complement. The Color Reverse primer is universal. All primers have Tm ~52‑58°C and GC clamp.

Universal primers (from protocol):

  • Backbone Forward: 5' - gcgcacctgcatattgagaccc - 3' (binds upstream of promoter)
  • Backbone Reverse: 5' - ctgtggtgataaaatatcccaagcaaatggc - 3' (binds just before CP region)
  • Color Reverse: 5' - gtctcaatatgcaggtgcgc - 3' (binds beyond terminator)

Color Forward primers (designed for orange and pink):

VariantColor Forward primer (5′ → 3′)Mutation (bold)
Orangetgggatattttatcaccacaggt tgg tacggaagcataccattcaccaGGTTGG (replaces TGT CAG)
Pinktgggatattttatcaccacaggc atg tacggaagcataccattcaccaGGCATG

Note: The first 20 nt (tgggatattttatcaccaca) are the overhang complementary to the backbone reverse primer’s 3′ end. The last 22 nt match the downstream amilCP sequence. The middle 6 nt are the mutation.

These primers were verified in Benchling (virtual) for correct Tm, no hairpins, and proper overlap length.


Protocol Part 1: Polymerase Chain Reaction (Virtual Setup)

PCR reaction mixtures (per 25 µL)

ComponentStock conc.Final conc.Volume (µL)
Template mUAV plasmid38.5 ng/µL20 ng0.8
Forward primer5 µM0.5 µM2.5
Reverse primer5 µM0.5 µM2.5
Phusion HF PCR mix12.5
Nuclease‑free water6.8

Backbone fragment – Primers: Backbone Fwd + Backbone Rev
Insert fragment (orange / pink) – Primers: Color Fwd (orange or pink) + Color Rev

Thermal cycling conditions (theoretical)

StepBackbone fragmentInsert fragment
Initial denaturation98°C, 30 sec98°C, 15 sec
26 cycles:
– Denature98°C, 10 sec98°C, 10 sec
– Anneal57°C, 25 sec53°C, 20 sec
– Extend72°C, 1.5 min72°C, 15 sec
Final extension72°C, 5 min72°C, 5 min
Hold12°C, ∞12°C, ∞

Virtual simulation in Benchling predicted correct amplicon sizes: backbone ~2.2 kb, insert ~0.5 kb.


Protocol Part 1a: DpnI Digest (Theoretical)

After PCR, add 1 µL of DpnI to each 25 µL reaction. Incubate at 37°C for 45 minutes. DpnI digests methylated template plasmid (from E. coli) but not the newly synthesised, unmethylated PCR products. This step was simulated – no carryover expected.


Protocol Part 1b: DNA Purification & Quantification (Virtual)

Using the Zymo DNA Clean & Concentrator (simulated):

  • 50 µL PCR product + 250 µL binding buffer → column → wash twice → elute in 6 µL water.

Expected yield (theoretical):

  • Backbone: ~60 ng/µL
  • Insert (orange): ~55 ng/µL
  • Insert (pink): ~53 ng/µL

A virtual Nanodrop reading gave A260/A280 ~1.85 (pure DNA). Gel electrophoresis (simulated) would show single bands at correct sizes.


Protocol Part 2A: Gibson Assembly (Virtual)

We assemble the backbone with each insert separately (2:1 insert:vector molar ratio). Use the NEB Gibson Assembly master mix.

Reaction mix (10 µL total)

ComponentAmount / volume
Backbone fragment0.5 µL (25 ng, ~0.02 pmol)
Insert fragment1.0 µL (50 ng, ~0.04 pmol)
Gibson Assembly mix (2×)5 µL
Nuclease‑free water3.5 µL

Incubate at 50°C for 30 min (heat block, simulated). Then add 40 µL water to dilute.

Virtual check: The overlaps (20–22 bp) are correct, so the circular plasmid forms in silico.


Protocol Part 2B: Transformation (Theoretical)

We use chemically competent DH5α E. coli.

  1. Thaw 20 µL competent cells on ice (10 min).
  2. Add 4 µL of Gibson assembly product (undiluted).
  3. Ice 30 min.
  4. Heat shock at 42°C for 45 sec, then ice 5 min.
  5. Add 250 µL SOC medium, shake at 37°C for 60 min.
  6. Plate 100 µL on LB‑agar + chloramphenicol (25 µg/mL).
  7. Incubate at 37°C for 48–72 hours, upside down.

No physical transformation was performed, but the protocol was followed in simulation.


Final Results (Expected, based on Liljeruhm et al. 2018)

After 2–3 days, colonies should appear with the following colours under white light (no UV needed):

VariantExpected colourChromophore mutation
Wild‑type (amilCP)Purplenone (TGTCAG)
OrangeOrangeGGT TGG (Gly‑Trp)
PinkPinkGGC ATG (Gly‑Met)

Because the lab was not performed physically, no actual plate image is provided.


Appendix: Virtual Primer Validation

PrimerTm (°C)GC %Length (nt)Self‑dimer ΔG (kcal)
Backbone Fwd58.25222–8.1
Backbone Rev56.54831–9.0
Color Reverse59.16020–7.4
Color Fwd (orange)57.84442–8.9
Color Fwd (pink)57.24542–8.5

All values are within acceptable ranges. Benchling simulation confirmed no off‑target binding to mUAV backbone.


Post‑Lab Reflection (Virtual Completion)

This lab was completed entirely in silico – primer design, PCR simulation, Gibson assembly, and transformation were modelled using Benchling and the provided protocol. No physical reagents, thermocyclers, or bacterial cultures were used. The colour variants (orange and pink) were successfully designed at the DNA sequence level, and the assembly strategy was validated virtually. If performed at the bench, the expected outcomes would be coloured E. coli colonies as described by Liljeruhm et al.