Week 6 HW: Genetic Circuits Part I: Assembly Technologies

Assignment: DNA Assembly

What are some components in the Phusion High-Fidelity PCR Master Mix and what is their purpose?

Based on Protocol for Phusion™ High-Fidelity PCR Master Mix with GC Buffer (https://www.neb.com/en-gb/protocols/protocol-for-phusion-high-fidelity-pcr-master-mix-with-gc-buffer-m0532)

Phusion DNA Polymerase - a high-fidelity enzyme that synthesises new DNA strands with 3’→5’ exonuclease activity for proofreading dNTPs - building blocks for DNA synthesis (200 µM each at 1X concentration) MgCl₂ - Cofactor required for polymerase activity (1.5 mM at 1X concentration) Possibly optional as the question doesn’t mention it (GC Buffer - optimised buffer for amplifying difficult templates with high GC content or secondary structure) DMSO (optional additive) - helps denature secondary structures in GC-rich or difficult templates (recommended at 3% final concentration)

What are some factors that determine primer annealing temperature during PCR?

Primer Tm as in melting temperature, primer length, GC content, primer pair Tm similarity

There are two methods from this class that create linear fragments of DNA: PCR, and restriction enzyme digests. Compare and contrast these two methods, both in terms of protocol as well as when one may be preferable to use over the other.

PCR vs. Restriction Enzyme Digests

Comparison Table

AspectPCRRestriction Enzyme Digests
MechanicsAmplifies specific DNA regions using primersCuts DNA at specific recognition sequences
FlexibilityMore flexible; doesn’t require specific cut sitesLimited by existing restriction sites in sequence
MutationsCan introduce mutations via primer designCannot introduce mutations
End ProductsVariable ends based on primer designCreates predictable, precise ends
Time needed~90 minutes with thermal cyclingFaster (~1-2 hours incubation)
Template amountCan work with small amounts of templateRequires sufficient DNA quantity
Sticky endsNot applicableCan create compatible sticky ends
When to useWhen introducing mutations into sequences, no suitable restriction sites exist in the DNA, from small amounts of template DNAWhen restriction sites are conveniently located in the sequence, Creating compatible sticky ends for cloning, Cutting plasmids for traditional cloning applications, Precise, predictable cuts are required

How can you ensure that the DNA sequences that you have digested and PCR-ed will be appropriate for Gibson cloning?

  1. Ensure primers have 20-22 bp overhangs that are complementary between fragments

  2. After PCR and DpnI digest, purify the DNA using the Zymo DNA Clean & Concentrator kit and measure concentration using Nanodrop/Qubit. The concentration should be above ~30 ng/µL.

  3. Run the PCR products on an agarose gel to verify correct band sizes. Mix 3 µL of sample with 3.3 µL of 6x Loading Dye, run at ~100 mV for 15 min, and compare against a DNA ladder. Calculate your predicted digest on Benchling to verify the correct band size matches what you see on the gel

  4. Ensure only unmethylated PCR products (not the original methylated template plasmid) are present through DpnI Treatment, reducing background colonies from unmutated template.

How does the plasmid DNA enter the E. coli cells during transformation?

By diffusion when the cells are shocked

Describe another assembly method in detail (such as Golden Gate Assembly) Explain the other method in 5 - 7 sentences plus diagrams (either handmade or online).

Golden Gate assembly is a molecular cloning technique used to join DNA fragments in a single reaction. Methods for golden gate include MoClo, GoldenBraid 2.0, Mobius assembly and EMMA. It’s an efficient and cost-effective means to generate construct variants. Type IIS restriction enzymes are used to assemble multiple fragments in a single reaction. It’s also important to make sure that the Type IIS included in the process is not present in the vector or insert sequences

Golden Gate Assembly method Golden Gate Assembly method Screenshot taken from https://www.youtube.com/watch?v=JuiJASyG9gc

Model this assembly method with Benchling or Asimov Kernel!

As we don’t have access to Asimove I’ll be modelling this with Benchling

  1. First, I added the DNA sequense of the well-known green fluorescent protein (GFP), which is native to the jellyfish Aequorea victoria

  2. Changed the GGTCTC to GGTCTT to be able to work with the Golden Gate Assembly. Then I’ve added the plasmid to the project. I used the same one described in the lab. Then I checked for the presence of GGTCTC to use as the typeII enzyme.. there were 2 of those. Checked the other ones 2 of those again. Basically all three Type IIS enzymes (BsaI, BbsI, and Esp3I) have recognition sites in the mUAV plasmid

  3. I ended up editing the GGTCTC ones as they were all in the base parts of the plasmid so they didn’t affect much. ( GGTCTC → GGTCTT )

  4. Then I figured out that amilCP gene starts at 2114 and ends at 2779 Complement: A↔T, G↔C

  5. I then loooked for stop codons and found the TAA one. For the primer design i also needed the 20 protein sequence of the GFP which was atgtctaaaggtgaagaatt. Basically my primer components ended up being BsaI site: GGTCTC, Overhang A: AATG (includes the ATG start codon) and the binding region which is those first 20 bp of GFP = atgtctaaaggtgaagaatt. Then for the reverse binding region, the positions of 666 to 685 (20 before the TAA) are TGGTCTTGTTAGAATTTGTT therefore reverse complement ones are AACAAATTCTAACAAGACCA

  6. End primers are GFP Forward 5’-GGTCTCAATGTCTAAAGGTGAAGAATT-3’ and GFP Reverse 5’-GAGACCAAGCAACAAATTCTAACAAGACCA-3'

  7. Then as for the backbone forward primer 5’-GGTCTCGCTTAAGCTTCAAATAAAACGAA-3’ as it is (taagcttcaaataaaacgaa) where GGTCTC is a BsaI recognition site, G a spacer base, and CTTAAGCTTCAAATAAAACGAA a binding region.

  8. Backbone Reverse ended up being 5’-GAGACCCATTTTAGTATTTCTCCTCTTTCT-3'

  9. Then knowing all this it’s time to do the Golden Gate Assembly Golden Gate Assembly method Golden Gate Assembly method

  10. Needed to change the setting from use cut lines otherwise i was getting an error Golden Gate Assembly method Golden Gate Assembly method but other than that it was a pretty straightforward process Golden Gate Assembly method Golden Gate Assembly method

and here are some final setting that I used

Golden Gate Assembly method Golden Gate Assembly method

all done !!! https://benchling.com/s/seq-7kPMc9tGfTBvUaQHkniq?m=slm-VIKLDWpNc1o4GKeuM4Ii

Golden Gate Assembly method Golden Gate Assembly method

Assignment: Asimov Kernel

(didn’t get access)