Projects

Final projects:

  • PLNC8 anti-Helicobacter pylori Helicobacter pylori is a gram-negative, microaerophilic bacterium that colonizes the gastric mucosa. It is usually acquired in childhood, can persist for life if untreated. It causes inflammation of the stomach lining, known as gastritis. This leads to the stomach making more acid than usual. This can cause open sores in the stomach/gastric ulcers, or in the upper part of the small intestine/duodenal ulcers. H. pylori is also linked to some types of stomach cancers. Bacteriocin PLNC8 is part of the IIB family of bacteriocins that are formed by 2 peptides, in our case PLNC8a and PLNC8b. Even though both peptides can act independently, their efficiency is much lower compared to when acting togheter. They are positively charged and attracted to the negatively charged cellular membrane of bacteria, directly perforating their walls by creating pores which let out ions and important resources leading to fast cellular death. The genes are extracted from the Lactobacillus Plantarum bacteria, among with another gene called OrfC with a role in the immunity of the host against the bacteriocin, preventing it from damaging itself. When searching for a way to improve the targeting of Helicobacter Pylori, I came across a chemotactic transmembrane receptor that is found in H. pylori itself, coded by the gene TLPB, which has a very high affinity for urea and ph. The mucosal lining of the stomach is the place where most urea is found, and H. pylori uses this receptor to migrate more easily across the stomach walls and colonize it, so by adding this gene into our Lactococcus Lactis, we can increase their contact. Lactococcus Lactis is a gram positive bacteria that is highly resistant to the acidic ph of the stomach, which is considered safe and amongst the best candidates used for probiotics. The Lactis strain naturally secrets an antibiotic called nisine that is used as a conservant in the alimentary industry. Studies also proved its great adherence to the stomach walls and its ability to co-agregate with pathogens while helping in the production of vitamine B9(folate) and inhibition of the alpha-glucosidase enzime regulating the patient’s glucose levels.

Subsections of Projects

Individual Final Project

PLNC8 anti-Helicobacter pylori

Helicobacter pylori is a gram-negative, microaerophilic bacterium that colonizes the gastric mucosa. It is usually acquired in childhood, can persist for life if untreated. It causes inflammation of the stomach lining, known as gastritis. This leads to the stomach making more acid than usual. This can cause open sores in the stomach/gastric ulcers, or in the upper part of the small intestine/duodenal ulcers. H. pylori is also linked to some types of stomach cancers. Bacteriocin PLNC8 is part of the IIB family of bacteriocins that are formed by 2 peptides, in our case PLNC8a and PLNC8b. Even though both peptides can act independently, their efficiency is much lower compared to when acting togheter. They are positively charged and attracted to the negatively charged cellular membrane of bacteria, directly perforating their walls by creating pores which let out ions and important resources leading to fast cellular death. The genes are extracted from the Lactobacillus Plantarum bacteria, among with another gene called OrfC with a role in the immunity of the host against the bacteriocin, preventing it from damaging itself. When searching for a way to improve the targeting of Helicobacter Pylori, I came across a chemotactic transmembrane receptor that is found in H. pylori itself, coded by the gene TLPB, which has a very high affinity for urea and ph. The mucosal lining of the stomach is the place where most urea is found, and H. pylori uses this receptor to migrate more easily across the stomach walls and colonize it, so by adding this gene into our Lactococcus Lactis, we can increase their contact. Lactococcus Lactis is a gram positive bacteria that is highly resistant to the acidic ph of the stomach, which is considered safe and amongst the best candidates used for probiotics. The Lactis strain naturally secrets an antibiotic called nisine that is used as a conservant in the alimentary industry. Studies also proved its great adherence to the stomach walls and its ability to co-agregate with pathogens while helping in the production of vitamine B9(folate) and inhibition of the alpha-glucosidase enzime regulating the patient’s glucose levels.

In this project, the construct was designed in Benchling, where the nucleotide sequences of the vector and all genes of interest were assembled in silico.I generated the plasmid using Gibson Assembly, because this method allows assembling multiple fragments in a single reaction.

For the plasmid I choose pNZ8148, because it was designed for heterologous expression in L. lactis, which is exactly what I needed for the peptides .

I chose to insert the 4 genes: PLNC8a, PLNC8b, orfC and TLPb into a strain of Lactococcus Lactis using pNZ8148 vector , then for each gene I searched for the following:

Promoter: GGTCCTCGGGATATGATAAGATTAATAGTTTTAGCTATTAATCTTTTTTTATTTTTATTTAAGAATGGCTTAATAAAGCGGTTACTTTGGATTTTTGTGAGCTTGGACTAGAAAAAAACTTCACAAAATGCTATACTAGGTAGGTAAAAAAATATTCGGAGGAATTTTGAA

Ribosome binding sequence: CGAAGGAACTACAAAATAAATTATAAGGAGGCACTCA

Terminator: CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA

His Tag: CATCACCATCACCATCATCAC

The genes sequences are:

PLNC8a: ATGGATAAATTTGAAAAAATTTCAACATCAAATTTAGAAAAGATCTCAGGCGGTGATTTAACAACCAAGTTATGGAGCTCATGGGGTTATTATCTTGGCAAGAAAGCTCGTTGGAATTTAAAGCACCCATATGTTCAATTTTGA

PLNC8b: ATGAATAACTTGAATAAATTTTCTACTCTAGGCAAGAGTAGCTTGTCTCAAATTGAGGGCGGATCAGTCCCAACTTCAGTATATACGCTTGGAATTAAAATTCTATGGTCTGCGTATAAGCATCGCAAAACGATTGAAAAAAGTTTTAATAAAGGCTTTTATCATTAA

OrfC: ATGGAGCTCTTGGGGATATATTATCTTGGCAAGAAAGCACGTTGGAATTTAAAGCACCCATATGTTCAATTTTAGGAGTGTTCAGTGTGATTAATAAATTTTTTTGAAAAGACATTAATTTTTGGGGTTGGTTGATTGTTTTTGTTTTTAGCGTAAAAGCAGCAGTGAATATTGATATGAGCAGTTTAGACTGGATTGTGCAGACTGTTTTTACAATTGTTAGTATTTTAGGCATTTGCCACGTATTGTTTCATAAGAAAAGTTTTCAAAAGTAA

TLPB: ATGGGAAAATTCATACAATGGATCAAACAGCCATCGATCAGCAAACCGCTAATCGCTGCGTTTCTGGCAGTGCTTATTTTGCCGGTTGGGGTTTTAGCATATTTCAGTTATCAATCAGCTTGGAACGCGTTAGACAGAGAGCTCATAAGCAGTGCGAAGGGAAATGTTGAAGAACTAAACAGTACGCTGCAAAATAAATTAGAAGATAAAGTAAAAGCAATAGATTATTATAGTGAGACAGTCGATAAAGACATATTGTTAGGCAAAAACAAAACATTACTGAAAGAGAAATTTAAGCAGTACACGACACTTAACGACGATGTAGGCGCAATCTATGCTGCCTCAGAAGATAAGAAGCTTTATAAATATCCGGATAGCGGTGTTCCGAAAGGTTTCGATCCGACAGGACGTGACTGGTACAAACAGGCGGTTGCGGAAAAAGGACAAGCTGTTTTCTCAGAACCGTATACCGATGAAGCGACAGGAGATATCGTTGTCACAATTTCAAAACAATTAAAAGACGGTTCAGGGGTTATAGCGCTAGATTTAAACCTGGATGAAGTGCTTACTGCATCAAAAAGAATCAAAATCGGAAAAGAAGGCTTTGCATTTATTACGACAGGCAACAAAAAATATATCGCCCATCCGACCATTAAGCCGGGGACAACCGGTTCCGGCGATTGGACAAACCAAGTATATTCCAAAAAAGAAGGCTCATTTGAATATACATTCGAAGGCAAAGAAAAGAAAATGGCCTTTACGACAAATAAACTGACTGGCTGGAAAATCGCGGGCATATATTTTGTCAGTGAATTGCAAGATGCTTCAAGCCCGGTGCTGAACACTGCGGTTATCATTCTATGCGTGTCAATAGTAATCGGCGGCATACTCATACTCTATATTATCCGTGCCATCACCAAGCCGTTAAGAAAACTTGTCTCAACGTCTGCAAAAATCAGCAGCGGAGATCTCACAGAAGTCATTGACATTCACTCGAAAAACGAGTTTGGCCAGCTTGGCGAAAGCTTTAATGAAATGTCTGCATCATTGCGTTCTGTAATAGGCGTTATTCAAACGTCTGTAGAAAACGTCGCTTCATCTTCTGAGGAGCTGACAGCAAGCGCAGCCCAAACAAGCAAGGCAACTGAACATATTACACTTGCCATCGAACAGTTCTCAGATGGCAACGAGGCACAAAGCGAGAAACTGGAAACAAGCTCAAATCATCTTTCTCAAATGAACGAGGGGATTTCAAAAGTGGCTCAAGCCTCTTCAACCATTACGAAATCATCGATTCAGTCCTCTGAGGCAGCGGGCAGCGGAGAAAAGCTGGTGGAGCATACAGTCGGCCAGATGAAAACAATTGACCAATCCGTTCAAAAAGCGGAAGCGGTTGTGAAGGGCCTTGAAACAAAATCGCAAGACATCACAAGCATCTTGAATGTGATTAACGGCATTGCTGATCAAACCAACCTGCTTGCATTAAATGCTGCGATTGAGGCGGCAAGAGCGGGAGAATACGGAAGAGGTTTCTCAGTAGTTGCGGAAGAGGTTAGAAAACTTGCTGTACAATCAGCAGACTCCGCCAAGGAAATTGAAGGATTAATTCAAGAGATTGTCAGGGAAATCAGCACCTCACTTTCAATGTTCCAATCCGTGAATCATGAAGTGAAAGAAGGCTTGCAGATTACGGATCAAACAGCGGAAAGCTTTAAACAAATCTATGAGATGACAACCCAAATTTCCGGCGAATTGCAAAACTTGAACGCGACGGTTGAACAACTGTCAGCCGGATCACAGGAAGTGTCAAGTGCTGTTGAAGATATTTCTGCAGTGGCGAAAGAAAGCTCAGCAGGCATTCAGGATATCGCAGCTTCGGCGGAAGAACAGCTTGCGTCCATGGAAGAAATCAGCTCTTCAGCGGAAACGTTGGCAAACATGGCGGAAGAACTTCAGGACATTACGAAGAAATTTAAAATAGAATCATAA

Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text Accessibility text

Resources: https://pmc.ncbi.nlm.nih.gov/articles/PMC9104758/ https://pmc.ncbi.nlm.nih.gov/articles/PMC344433/ https://pmc.ncbi.nlm.nih.gov/articles/PMC1428400/ https://www.ebi.ac.uk/ena/browser/api/embl/DQ340868.2?lineLimit=1000 https://www.ebi.ac.uk/ena/browser/api/embl/L29189.1?lineLimit=1000 https://www.novoprolabs.com/vector/Vgezdqmbu

https://pubmed.ncbi.nlm.nih.gov/20659775/

https://pmc.ncbi.nlm.nih.gov/articles/PMC93821/

https://www.healthdirect.gov.au/helicobacter-pylori

https://pmc.ncbi.nlm.nih.gov/articles/PMC9104758/

Group Final Project

cover image cover image