Week 2 HW: dna-read-write-and-edit

PART 1

Benchling & In-silico Gel Art

  • Make a free account at benchlig.com
  • Import the Lambda DNA

Benchling navigation notes for importing the Lambda DNA:

Find the Lambda DNA sequence from the NCBI database:

GenBank ID number: J02459.1

Copy/Paste GenBank ID number into Benchling:

DNA/RNA sequence: Import DNA/RNA sequences

Fig 1. Fig 1.

Fig 1. Linear map of lambda DNA (LAMCG) imported into Benchling, showing all enzymes with their cut sites on the DNA.

  • Simulate Restriction Enzyme Digestion with the following enzymes:
  • EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI

Benchling navigation notes for in-silico enzyme digestions:

On the Linear Map tab:

Click the “Digests” icon on the left. This opens up the new digest and saved digest menu.

Under the New Digest tab, type the enzyme name in the “Find enzyme” search bar.

Select the desired enzyme to highlight. (Fig 2) Hit “Run Digest”.

Next, name the digest: i.e., Digest-EcoRI. (Fig 3) Hit “Save”.

To simulate all enzymes in the same experiment, repeat the digestion of each desired enzyme.

To view the simulation of all digests, click the “Virtual Digest” tab. (Fig 4)

Fig 2. Fig 2.

Fig 2. Selecting an enzyme on Benchling.

Fig 3. Fig 3.

Fig 3. Naming and saving the digest on Benchling (arrow pointing to the naming box).

Fig 4. Fig 4.

Fig 4. Simulating restriction enzyme digestion of lambda DNA on Benchling.

Enzymes: EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI.

  • Create a design/pattern artwork.
  • I created the following design pattern by simulating combined restriction enzyme digestions in single, double, and triple enzymes.
  • I virtually ran the experiment from saved simulations in Benchling.
Fig 5. Fig 5.

Fig 5. Design pattern generated by simulated restriction enzyme digestions of lambda DNA on Benchling.

PART 2

GelArt - Restriction Digests and Gel Electrophoresis

Virtual Experiment (see Fig 5)

PART 3

DNA Design Challenge

3.1. Choose your protein

Which protein have you chosen?

I’ve chosen Histidine Ammonia-Lyase (HAL) enzyme. HAL converts L-histidine to trans-urocanic acid (trans-UCA) and ammonia.

Why choose Histidine Ammonia-Lyase (HAL)?

Found in human skin, the enzyme, HAL, catalyzes trans-urocanic acid (trans-UCA) formation, which has skin moisturizing properties and is implicated in skin disease management. Topical application of a cis-urocanic acid (UV-induced isomeric form) in combination with orally administered histidine has shown to be effective in the management of atopic dermatitis (AD), the most common form of eczema (Peltonen et al 2014).

Trans-UCA is naturally liberated from histidine-rich filaggrin monomers of a major epidermis protein in skin. As part of the skin’s natural moisturizing factor, trans-UCA provides important functions in maintaining the skin’s hydration, pH balance, epidermal barrier integrity, and skin’s microbial community balance (Debinska 2021, Kim and Lim 2021).

AD is caused by dysfunction in the epithelial barrier and the overactivation of the immune system. Pathology of the disease is viewed as beginning with a dysfunction in the epithelial barrier. There is no cure, but management includes the application of daily moisturizers and corticosteroids to improve the skin barrier function. In severe cases, biologics-based therapies such as monoclonal antibodies targeting cytokine signaling pathways are available (Debinska 2021).

As a synthetic biology application, I have designed a microbial expression system to produce trans-UCA from yeast for clinical use as an active ingredient in a lotion. HAL homologs are found in microbes, such as bacteria and certain groups of fungi. But common yeast, Saccharomyces cerevisiae, does not have a HAL homolog. I chose the yeast as the host organism to produce trans-UCA because yeast has several advantages as an expression system: the GRAS status and lack of endotoxin production. The Pseudomonas putida hutH gene, which encodes for HAL, is the microbial source for trans-UCA production (Hernandez and Phillips 1993).

References:

Peltonen, J. M., L. Pylkkanen, C. T. Jansen, I. Volanen, T. Lehtinen, J. K. Laihia, and L. Leino. 2014. Three randomized phase 1/IIa trials if 5 % cis-urocanic acid emulsion cream in healthy adult subjects and in patients with atopic dermatitis. Acta Derm Venereol. https://doi.org/10.2340/00015555-1735

Debinska, A. 2021. New treatments for atopic dermatitis targeting skin barrier repair via the regulation of FLG expression. J. of Clinical Medicine. https://doi.org/10.3390/jcm10112506

Kim, Y. and KM Lim. 2021. Skin barrier dysfunction and filaggrin. *Arch. Pharm. Res.*Peltonen, J. M., L. Pylkkanen, C. T. Jansen, I. Volanen, T. Lehtinen, J. K. Laihia, and L. Leino. 2014. Three randomized phase 1/IIa trials if 5 % cis-urocanic acid emulsion cream in healthy adult subjects and in patients with atopic dermatitis. Acta Derm Venereol. https://doi.org/10.2340/00015555-1735

Hernandez D. and A. T. Phillips. 1993. Purification and characterization of Pseudomonas putida histidine ammonia-lyase expressed in Escherichia coli. Protein Expression and Purification. https://doi.org/10.1006/prep.1993.1062

I used Google, ChatGPT, and Claude searches.

  • Protein sequence obtained from UniProt:
Fig 6. Fig 6.

3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence

Histidine Ammonia-Lyase (HAT) DNA sequence

Original DNA sequence from NCBI

GenBank: M35140.1

Fig 7. Fig 7.

Using Reverse Translation Tools: Sequence Manipulation Suite

Fig 8. Fig 8.
  • Validating the DNA sequence obtained by reverse translation from the amino acid sequence:
  • The DNA sequence obtained by reverse translation generated the identical amino acid sequence of the protein listed in UniProt database.
Fig 9. Fig 9.

3.3. Codon optimization

I am creating a yeast expression system for Histidine Ammonia-Lyase (HAT) production. The gene encoding the HAT enzyme will be sourced from Pseudomonas putida, the hutH gene. Since the efficiency of producing this protein will be strongly influenced by the host organism’s codon usage, the hutH DNA sequence should be optimized for codon usage in yeast. I used the IDT’s codon optimization tool to generate the codon-optimized DNA sequence.

Codon-optimized DNA sequence of the P. putida hutH gene.

Fig 10. Fig 10.

3.4. You have a sequence! Now what?

I plan to use a cell-dependent method to express and purify the Histidine Ammonia Lyase (HAT) enzyme. The host organism, yeast, uses its DNA replication, transcription, and translation systems to make more copies of the DNA on the expression plasmid. While the DNA is copied, the transcription and translation system decodes the DNA to make proteins. Depending on the copy size of the expression plasmid, we expect more proteins to be produced from a self-replicating plasmid in cells, increasing the production yield. The expression system targets the enzyme to be exported outside of cells, creating more efficient downstream processing.

PART 4

Prepare a Twist DNA Synthesis Order

4.1. Create a Twist account and a Benchling account

4.2. Build Your DNA Insert Sequence

I am using a yeast expression vector from Twist Bio, pTwist_PIC9.

Features in the pTwist_PIC9 vector:

AOX1 promoter, methanol-inducible

Alpha-factor secretion signal sequence, which contains its translation initiation signal, Kozak-like sequence, and the initiation codon (ATG)

AOX1terminator

The insert sequence: the codon-optimized hutH gene from P. putida:

  • The initiation codon (ATG) is removed due to the existing initiation codon in the alpha factor secretion sequence.
  • Unique restriction enzyme sites added: SnaBI (TACGTA) at the N-terminus for in-frame cloning with the alpha-factor secretion signal sequence and NotI (GCGGCCGC) at the C-terminus.
  • 7x His Tag is added at the C-terminus site: CATCACCATCACCATCATCAC (provided for a proof-of-concept)
  • Stop codon is added: TAA

Linear Map of the final expression plasmid: pTwist_PIC9_hutH_histag

Benchling link:

https://benchling.com/s/seq-y5m2rFDiWbhGhUTuNVsT?m=slm-xuufMLauQwcB80ujHEx6

Fig 11. Fig 11.

PART 5

DNA/Read/Write/Edit

5.1 DNA Read

What DNA would you want to sequence (e.g., read) and why?

I want to read the DNA from the human skin microbiome and compare it with healthy and diseased conditions. By doing so, it may be possible to figure out missing beneficial microbes in the disease condition. This could allow us to design probiotics that could help reverse disease conditions.

What technology or technologies would you use to perform sequencing on your DNA, and why?

I would most likely need to perform shotgun sequencing to capture all the DNA present on the skin by fragmenting and sequencing the individual fragmented DNA and later assembling the sequences by bioinformatics methods. Sequencing all DNA is the most comprehensive approach.

5.2 DNA Write

What DNA would you want to synthesize (e.g., write) and why?

What technology or technologies would you use to perform this DNA synthesis, and why?

5.3 DNA Edit

What DNA would you want to edit and why?

What technology or technologies would you use to perform these DNA edits, and why?