Week 2 HW: DNA, Read, Write and Edit

I’ve chosen Histidine Ammonia-Lyase (HAL) enzyme. HAL converts L-histidine to trans-urocanic acid (trans-UCA) and ammonia.

Found in human skin, the enzyme, HAL, catalyzes trans-urocanic acid (trans-UCA) formation, which has skin moisturizing properties and is implicated in skin disease management. Topical application of a cis-urocanic acid (UV-induced isomeric form) in combination with orally administered histidine has been shown to be effective in the management of atopic dermatitis (AD), the most common form of eczema (Peltonen et al 2014).

Trans-UCA is naturally liberated from histidine-rich filaggrin monomers of a major epidermis protein in skin. As part of the skin’s natural moisturizing factor, trans-UCA provides important functions in maintaining the skin’s hydration, pH balance, epidermal barrier integrity, and skin’s microbial community balance (Debinska 2021, Kim and Lim 2021).

AD is caused by dysfunction in the epithelial barrier and the overactivation of the immune system. Pathology of the disease is viewed as beginning with a dysfunction in the epithelial barrier. There is no cure, but management includes the application of daily moisturizers and corticosteroids to improve the skin barrier function. In severe cases, biologics-based therapies such as monoclonal antibodies targeting cytokine signaling pathways are available (Debinska 2021).

As a synthetic biology application, I have designed a microbial expression system to produce trans-UCA from yeast for clinical use as an active ingredient in a lotion. HAL homologs are found in microbes, such as bacteria and certain groups of fungi. But common yeast, Saccharomyces cerevisiae, does not have a HAL homolog. I chose the yeast as the host organism to produce trans-UCA because yeast has several advantages as an expression system: the GRAS status and lack of endotoxin production. The Pseudomonas putida hutH gene, which encodes for HAL, is the microbial source for trans-UCA production (Hernandez and Phillips 1993).

I’ve used Google, ChatGPT, and Claude searches.

Prompts:

1. Can you research proteins that can be developed as therapies for skin diseases such as eczema?

2. Can you research the development of the production of cis-urocanic acid in a biotechnologically relevant host system? What genes are needed to produce cis-urocanic acid?

3. Can you compare the stability of trans-UCA and cis-UCA? Can you research what the best ammonia removal strategies are in a cell-free production system that primarily forms trans-UCA?

4. Can you research what the possible formulation components should be for trans-UCA as the active pharmaceutical ingredient applied topically for atopic dermatitis therapy? What buffer system, cryoprotectant, surfactant, and excipients should be used for achieving maximum effectiveness in treatment and shelf-life stability?

The efficiency of protein production is strongly influenced by the host organism’s codon usage. Preferences for a codon recognition sequence and the rate of synthesis for amino acid carriers, transfer RNA, are expected to differ in each lineage of living systems. To take care of the codon usage barrier, one could take this into account in the design, synthesizing the DNA code and avoiding codon usage limitations.

I am using a yeast species as the host organism for expressing the hutH gene for histidine ammonia lyase production. I decided on the yeast expression system due to its well-developed protein expression systems, which are robust and have a “generally safe” status. The yeast-derived protein products would be easily accepted for clinical use since they have the GRAS status. The histidine ammonia lyase is the catalyst for making trans-uroconic acid for skin therapeutic use.

The hutH gene will be sourced from the bacterial species Pseudomonas putida, where the gene is well-characterized. Since the hutH coding sequence is bacteria-sourced, it should be optimized for codon usage in the yeast, the production strain, not bacteria.

I’ve used the IDT Codon Optimization Tool to generate the codon-optimized DNA sequence for yeast.

Codon-optimized gene expression will allow a robust production of the protein in the host. It will be expressed from a well-characterized promoter in the yeast expression plasmid. Depending on the copy size of the expression plasmid, we expect more proteins to be produced from a self-replicating plasmid in cells, increasing the production yield. The expression system targets the enzyme to be exported outside of cells, creating more efficient downstream processing.

The initiation codon (ATG) is removed due to the existing initiation codon in the alpha factor secretion sequence in pTwist_PIC9.

Unique restriction enzyme sites added: SnaBI (TACGTA) at the N-terminus for in-frame cloning with the alpha-factor secretion signal sequence and NotI (GCGGCCGC) at the C-terminus.

7x his-tag is added at the C-terminus site: CATCACCATCACCATCATCAC

Stop codon is added: TAA

I’d like to read the DNA from the human skin microbiome and compare it with healthy and diseased conditions. Findings from comparative studies would reveal insight into dysbiosis and could potentially lead to rationally designed probiotics as therapeutics, which may help reverse disease conditions.

• Method: I would use the second-generation sequencing method (Illumina shotgun metagenomic sequencing) because it is a more economical and applicable method in metagenomic sequencing, constructing metagenome-assembled genomes, and whole metagenome analysis, capturing the entire sequence of the skin microbiome and analysis. (Yang et al. 2021, Chen et al. 2023)

• Input DNA and preparation. The input is genomic DNA of the microbiome from skin. The skin microbiome has low microbial biomass. Working with low-abundance samples can be challenging, leading to poor-quality downstream genomic DNA and data analysis. Additionally, human DNA is often a contaminant that needs to be removed before sequencing. (Bjerre et al. 2019.)

After isolating genomic DNA from the skin samples and removing the human DNA, I would fragment the genomic DNA for the sequencing library construction. For this, I would use an enzymatic method such as Tn5 transposase to randomly cleave DNA. Because the Illumina sequencing can read between 75 and 300 bp, fragmented DNA should be selected appropriately by selectively capturing the DNA fragments on beads.

Next, DNA ends should be repaired to have blunt ends, and a single adenine is added to the 3’ ends, creating A-tailing, which helps to establish directionality.

In the following steps, I would add Illumina adapters, where the adapters are ligated to the DNA at both ends. Illumina adaptors will serve as an anchor for the DNA to be immobilized on the flow cell surface. Next is the PCR amplification step to increase the copies of the adaptor-ligated DNA to ensure that the library has sufficient copies of the DNA fragments. Finally, PCR-amplified DNA is size-selected, and quality is assessed by a fragment analyzer.

• Sequencing technology. It is a synthesis-based technology, sequencing by synthesis (SBS). The flow cell is pre-loaded with oligos that have complementarity to the Illumina adapters. Once the library is loaded on the flow cell, DNA hybridizes with both ends to the complementary oligos, forming a curved arch.

The next step is bridge PCR to make about 1000 clones of each molecule, as necessary for signal amplification.

The following step is the SBS, where DNA polymerase incorporates 3’-blocked fluorescently labeled nucleotides. Blocker is reversible, allowing incorporation of nucleotides in each cycle, with only a single base per cycle.

Simultaneously, in each cycle of incorporation, the camera captures images as generated by the excitation and emission of fluorescent dye. Image analysis software processes and calls the base.

Once the DNA polymerase completes the incorporation of nucleotides, the synthesized DNA strand is washed away, and the entire process is repeated from the other end, so it is paired-end, superior to single-read sequencing because both ends of sequencing are performed in separate rounds, providing better data accuracy on the same fragment.

• Output. On a MiSeq, the output is 250-300 bp, with paired-end reads, 600 reads per DNA fragment.

I’ve used Claude research.

Prompts:

Can you research sequencing methods used in the skin microbiome research? I want to know about the functionality of the microbiome in disease states. Did they perform de novo genome assemblies to learn about functional pathways (loss of activity or hyperactivity) in disease conditions?

Can you research the second-generation sequencing method? Explain the preparation steps and how the method does base calling.

I want to synthesize an enzyme for therapeutic development purposes. One example is histidine ammonia lyase (HAL), which converts histidine into trans-urocanic acid (trans-Uro) and ammonia. Trans-Uro has an important function in maintaining skin barrier function. The product can be used as a topical application to manage skin disease such as atopic dermatitis. (Debinska 2021, Peltonen et al. 2014)

Trans-Uro can be produced from a cell-free expression system. To express and purify the catalyst HAL, I’d like to create a yeast expression system expressing the gene hutH encoding HAL. A gene block synthesis can provide the hutH gene to be cloned into an existing yeast expression vector.

• Technologies: The hutH gene for the HAL coding sequence alone is 1530 bp (Hernandez and Phillips 1993). The DNA of this size, as a gene block, cannot be synthesized. It needs to be synthesized as short, overlapping oligos and later assembled.

Synthesis technologies: the most widely used are the 1st-generation or the 2nd-generation technologies based on phosphoramidite chemistry, and they achieve 200 nt. The emerging new technology, the 3rd generation, is based on the terminal deoxynucleotidyl transferase (TdT) enzyme, which achieves 300 nt.

Assembly technologies: OE-PCR (overlap extension PCR) or PCA (polymerase cycling assembly) are applied to most fragments under 1000 bp. Gibson assembly is applied to fragments larger than 1500 bp.

• Essential steps in enzymatic synthesis. Although the phosphoramidite chemistry is widely used and available, the 3rd-generation enzyme synthesis technology is more environmentally friendly, as it has no toxic organic solvent use. I would consider the enzymatic method.

The TdT enzyme adds 3’-blocked nucleotides to the 3’-OH of the growing chain. A wash step removes unincorporated nucleotides. Then, a free 3’-OH is generated by cleaving the 3’-blocking group. The cycle is considerably shorter, 10-40 seconds, in comparison to the phosphoramidite method, which is 4-10 minutes.

• Limitations. TdT enzyme adds nucleotides randomly. So, the synthesis must be controlled by temporarily blocking the 3’-OH. Modifications are not as easy as the phosphoramidite method. As it emerges, its availability is currently limited.

• Essential steps in OE-PCR and Gibson assembly. First, a set of overlapping oligos is designed for both strands. Primers are synthesized by the phosphoramidite method, pooled, and assembled in a thermocycling extension reaction. The full-length fragment is then amplified by PCR with two flanking outer primers.

• Limitations. The error rate is 1 in 500 - 1000 bp assembled products, which require sequencing for verification.

For a gene block larger than 1500 bp, the Gibson assembly is used by creating multiple sub-fragments of 300-800 bp size by OE-PCR. The sub-fragments would have 20-40 bp overlapping ends. Final assembly is performed in a single isothermal reaction.

I’ve used Claude research.

Prompts:

Can you research what technologies are used for synthesizing SNA (DNA write)? To make a gene block, explain what technologies can be used. To make a construct, including the vector, explain what technologies can be used.