Week 1 HW: Principles and Practices

Application Idea:

The development of an engineered bacterial biosensor for real-time hydration detection as a preventive health measure in aging populations.

An engineered skin bacterium, applied as a lotion on the wrist or forearm, could detect body hydration levels and generate an electric current detectable by an electronic wearable component.

Why develop this application?

Water is vital for health, and yet, neglecting hydration is common. The elderly are particularly vulnerable. Dehydration perturbs the gastrointestinal (GI) tract, leading to difficulty passing stool and overall adverse effects on GI health.

The idea for this project was inspired by a non-invasive detection method that works via contact with skin that can be sampled for several parameters, not exclusively for hydration. Others, such as amino acids for nutritional status and glucose for insulin levels, can be measured and are directly read out from the body’s blood.

The skin readout for the body’s hydration status, as well as mental activity, has recently been developed by the University of California, Berkeley researchers (Kim et al 2025). The method is based on a microfluidic sensor device that uses the skin’s electrical property, the electrodermal activity.

The proposed project uses the synthetic biology approach, a biosensor that can report the body’s hydration status in real-time. Technologies for building such a biosensor are out there, such as the utility of the osmolarity-responsive operon (Rashid et al 2023) and the electric current generator, which is a synthetic electron transport chain (Atkinson et al 2022), but engineered skin bacteria as biosensors have not been made specifically for health preventive measures. This project is aimed at testing the bacterial commensal organisms as biosensors working via the skin.

References:

Kim, S-R., Y. Zhan, N. Davis, S. Bellamkonda, L. Gillan, E. Hakola, J. Hiltunen, and A. Javey. 2025. Nature Electronics.

Rashid, F-Z. M., F. G. E. Cremazy, A. Hofmann, D. Forrest, D. C. Grainger, D. W. Heermann, and R. T. Dame. 2023. Nature Communications.

Atkinson, J. T., L. Su, X. Zhang, G. N. Bennett, J. J. Silberg, and C. M. Ajo-Franklin. 2022. Real-time bioelectronic sensing of environmental contaminants. Nature.

Major governance policies

1. Establishing genome repositories for synthetic microbiome species
2. Ensuring do not release through biocontainment strategies
3. Adopting validation studies as an alternative to animal testing
4. Comply with regulatory on human subjects’ clinical trials
5. Documenting product safety through environmental toxicology studies
6. Implementing incentives and educational workshops

Establishing genome sequence repositories for synthetic microbiome species

Bacterial species used in this project, isolated and sequenced from the skin microbiome, should be recorded according to the general rules applies to biological agents. Any variations made into the organism through recombinant DNA techniques, including the introduction of DNA from other sources, should be recorded to comply with biosecurity rules.

Ensuring do not release through biocontainment strategies

Genetically modified organisms should not be released to the environment. Biocontainment strategies should be in place to ensure that the genetically engineered organism, for therapeutic interventions, cannot survive in the environment. One way to do this is through codon engineering, specifically for a non-canonical amino acid, which would create a dependency for the unnatural amino acid, which is lacking in the environment.

Subgoal: Non-canonical amino acids are expensive. Biomanufacturing cost will increase due to the need for that substrate. One way to reduce the cost is to have on-site manufacturing of non-canonical amino acids from precursors. Because precursors can be toxic, the manufacturing of chemicals needs to comply with local regulatory rules, such as building and equipment and engineering requirements.

Adopting validation studies as an alternative to animal testing

As an alternative to animal testing, validation studies should be based on artificial organoid-based systems. This ensures cruelty-free ethical conduct. Artificial skin models are already being developed and are available for monitoring the interstitial fluid compartment. Artificial 3D print skin models with built-in complexities, such as immune cells, could provide a setup for an initial understanding of the performance of the biosensor.

Comply with regulatory on volunteering human subjects’ clinical trials

Live organisms cannot be tested on humans without following laws, regulations, and guidelines applicable at the national and international levels. To demonstrate the clinical efficacy of the live organism, proper documentation and requesting permission should be established for the approval process.

Implementing incentives and educational workshops

General public acceptance of genetically modified organisms (GMOs) applied to the skin may be received with resistance. Educational workshops and materials should be available to the general public, as they introduce commensal microorganisms on skin and their genetic manipulation for biocontainment. A way to encourage participation is to implement an incentive system, such as a subscription with health insurance that includes paid benefits.

Based on the above, I would prioritize establishing regulatory policies regarding:

1. Generating genome sequence repositories,
2. Ensuring do not release through biocontainment applications,
3. Documenting product safety through environmental toxicology studies

Although it is not a priority, general public education on the use of engineered organisms to monitor biomarkers is important because it would create buy-in for health preventive products.

Assignment Week 2 Lecture Prep

Homework questions from Professor Jacobson:

1. Nature’s machinery for copying DNA is called polymerase. What is the error rate of polymerase? How does this compare to the length of the human genome? How does biology deal with that discrepancy?

Depending on the polymerase, the error rate ranges from 10⁻⁶ to 10⁻⁴.

The human genome length is 3.2 x 10^9 bp.

We could expect at least 3.2 × 10^3 errors occurring per replication.

There are multiple mechanisms employed to deal with this discrepancy:

• a. base selection
• b. proofreading
• c. mismatch repair

Mutation rates are lowest when 3 mechanisms are working together. It is reported that the mutation rate per base pair in prokaryotes is 2.6 x 10⁻¹⁰ and in eucaryotes is 3.3 x 10⁻¹⁰.

• The initial base selection ensures incorporation of the correct nucleotide 200,000 to 2000,000 times more likely.
• Having a proofreading activity, the polymerase can detect errors and uses exonuclease activity to remove incorrect nucleotides, improving fidelity by 40 to 200-fold.
• The mismatch repair system detects mismatches that escaped proofreading and catalyzes excision and synthesis, improving fidelity by 20 to 400-fold.

References:

R.M. Schaaper. 1993. Base selection, proofreading, and mismatch repair during DNA replication in Escherichia coli. The Journal of Biological Chemistry.

I’ve used lecture slides and Claude’s search.

2. How many different ways are there to code DNA (DNA nucleotide code) for an average human protein? In practice, what are some of the reasons that all of these different codons don’t work to code for the protein of interest? There are 64 codon combinations to code for all 20 amino acids. Most amino acids have more than 1 code, except methionine and tryptophan. Leucine, serine, and arginine have 6 different codons each.

An average human protein of about 469 amino acids can be coded by many combinations of DNA sequences that are too many to count. But not all coding would work. Some of the reasons are the following:

In practice, synonymous codons won’t work because of codon bias, which is organism-specific. Also, synonymous codons’ corresponding tRNAs might be less abundant in a given organism. In this situation, rare codons will have slow translation efficiency. Protein folding efficiency would also be slow. Synonymous codons may also cause mRNA instability.

References:

I’ve used lecture slides and Claude’s search.

Homework questions from Dr. LeProust:

1. What is the most commonly used method for oligo synthesis currently?

The most commonly used method for oligo synthesis currently is the phosphoramidite method developed in the 1980s.

2. Why is it difficult to make oligos longer than 200 nt via direct synthesis?

It is difficult to make oligos longer than 200 nt via direct synthesis because of the accumulation of errors, leading to a greater percentage of the product being truncated.

3. Why can’t you make a 2000 bp gene via direct oligo synthesis?

A 2000 bp gene cannot be made via direct oligo synthesis due to the accumulation of errors. A direct synthesis is limited to 200 nt. A 2000 bp gene can be made through the enzymatic assembly of shorter pieces by PCR.

References:

I’ve used lecture slides and Claude’s search.

Homework questions from Professor George Church:

Using Google & Prof. Church’s slide #4:

What are the 10 essential amino acids in all animals, and how does this affect your view of the “Lysine Contingency”?

The following amino acids are essential in all animals: His, Ile, Leu, Lys, Met, Phe, Thr, Trp, Val, and Arg.

Protein synthesis by the animal is more sensitive to lysine deficiency because animal proteins are rich in lysine; a slight decrease in lysine intake can influence the rate of protein synthesis (Ball et al 2007). I learned that not all proteins are rich in lysine; proteins in plants and grains are low in lysine (Mathews 2020), unlike proteins from animal sources.

As I read about the following study conducted in Pakistan, I believed in the importance of lysine supplementation in the human diet. A study conducted in Pakistan showed that wheat flour fortified with lysine improved the weight and height of children as compared to a control group (Hussain et al. 2004).

References:

Ball, R. O., K. L. Urschel, and P. B. Pencharz. 2007. Nutritional consequences of interspecies differences in arginine and lysine metabolism. The Journal of Nutrition.

Mathews, D. E. 2020. Review of lysine metabolism with a focus on humans. The Journal of Nutrition.

Hussain, T., S. A. Mushtaq, A. Khan, and N. S. Scrimshaw. 2004. Lysine fortification of wheat flour improves selected indices of the nutritional status of predominantly cereal-eating families in Pakistan. Food and Nutrition Bulletin, The United Nations University.

I’ve used lecture slides, ChatGPT, and Google Scholar search.

Prompts:

“What are the essential amino acids in all animals?”

“ Can you research the lysine contingency?”

Week 2 HW: dna-read-write-and-edit

PART 1

Benchling & In-silico Gel Art

• Make a free account at benchlig.com
• Import the Lambda DNA

Benchling navigation notes for importing the Lambda DNA:

Find the Lambda DNA sequence from the NCBI database:

GenBank ID number: J02459.1

Copy/Paste GenBank ID number into Benchling:

DNA/RNA sequence: Import DNA/RNA sequences

Fig 1. Linear map of lambda DNA (LAMCG) imported into Benchling, showing all enzymes with their cut sites on the DNA.

• Simulate Restriction Enzyme Digestion with the following enzymes:
• EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI

Benchling navigation notes for in-silico enzyme digestions:

On the Linear Map tab:

Click the “Digests” icon on the left. This opens up the new digest and saved digest menu.

Under the New Digest tab, type the enzyme name in the “Find enzyme” search bar.

Select the desired enzyme to highlight. (Fig 2) Hit “Run Digest”.

Next, name the digest: i.e., Digest-EcoRI. (Fig 3) Hit “Save”.

To simulate all enzymes in the same experiment, repeat the digestion of each desired enzyme.

To view the simulation of all digests, click the “Virtual Digest” tab. (Fig 4)

Fig 2. Selecting an enzyme on Benchling.

Fig 3. Naming and saving the digest on Benchling (arrow pointing to the naming box).

Fig 4. Simulating restriction enzyme digestion of lambda DNA on Benchling.

Enzymes: EcoRI, HindIII, BamHI, KpnI, EcoRV, SacI, SalI.

• Create a design/pattern artwork.
• I created the following design pattern by simulating combined restriction enzyme digestions in single, double, and triple enzymes.
• I virtually ran the experiment from saved simulations in Benchling.

Fig 5. Design pattern generated by simulated restriction enzyme digestions of lambda DNA on Benchling.

PART 2

GelArt - Restriction Digests and Gel Electrophoresis

Virtual Experiment (see Fig 5)

PART 3

DNA Design Challenge

3.1. Choose your protein

Which protein have you chosen?

I’ve chosen Histidine Ammonia-Lyase (HAL) enzyme. HAL converts L-histidine to trans-urocanic acid (trans-UCA) and ammonia.

Why choose Histidine Ammonia-Lyase (HAL)?

Found in human skin, the enzyme, HAL, catalyzes trans-urocanic acid (trans-UCA) formation, which has skin moisturizing properties and is implicated in skin disease management. Topical application of a cis-urocanic acid (UV-induced isomeric form) in combination with orally administered histidine has shown to be effective in the management of atopic dermatitis (AD), the most common form of eczema (Peltonen et al 2014).

Trans-UCA is naturally liberated from histidine-rich filaggrin monomers of a major epidermis protein in skin. As part of the skin’s natural moisturizing factor, trans-UCA provides important functions in maintaining the skin’s hydration, pH balance, epidermal barrier integrity, and skin’s microbial community balance (Debinska 2021, Kim and Lim 2021).

AD is caused by dysfunction in the epithelial barrier and the overactivation of the immune system. Pathology of the disease is viewed as beginning with a dysfunction in the epithelial barrier. There is no cure, but management includes the application of daily moisturizers and corticosteroids to improve the skin barrier function. In severe cases, biologics-based therapies such as monoclonal antibodies targeting cytokine signaling pathways are available (Debinska 2021).

As a synthetic biology application, I have designed a microbial expression system to produce trans-UCA from yeast for clinical use as an active ingredient in a lotion. HAL homologs are found in microbes, such as bacteria and certain groups of fungi. But common yeast, Saccharomyces cerevisiae, does not have a HAL homolog. I chose the yeast as the host organism to produce trans-UCA because yeast has several advantages as an expression system: the GRAS status and lack of endotoxin production. The Pseudomonas putida hutH gene, which encodes for HAL, is the microbial source for trans-UCA production (Hernandez and Phillips 1993).

References:

Peltonen, J. M., L. Pylkkanen, C. T. Jansen, I. Volanen, T. Lehtinen, J. K. Laihia, and L. Leino. 2014. Three randomized phase 1/IIa trials if 5 % cis-urocanic acid emulsion cream in healthy adult subjects and in patients with atopic dermatitis. Acta Derm Venereol. https://doi.org/10.2340/00015555-1735

Debinska, A. 2021. New treatments for atopic dermatitis targeting skin barrier repair via the regulation of FLG expression. J. of Clinical Medicine. https://doi.org/10.3390/jcm10112506

Kim, Y. and KM Lim. 2021. Skin barrier dysfunction and filaggrin. *Arch. Pharm. Res.*Peltonen, J. M., L. Pylkkanen, C. T. Jansen, I. Volanen, T. Lehtinen, J. K. Laihia, and L. Leino. 2014. Three randomized phase 1/IIa trials if 5 % cis-urocanic acid emulsion cream in healthy adult subjects and in patients with atopic dermatitis. Acta Derm Venereol. https://doi.org/10.2340/00015555-1735

Hernandez D. and A. T. Phillips. 1993. Purification and characterization of Pseudomonas putida histidine ammonia-lyase expressed in Escherichia coli. Protein Expression and Purification. https://doi.org/10.1006/prep.1993.1062

I used Google, ChatGPT, and Claude searches.

• Protein sequence obtained from UniProt:

3.2. Reverse Translate: Protein (amino acid) sequence to DNA (nucleotide) sequence

Histidine Ammonia-Lyase (HAT) DNA sequence

Original DNA sequence from NCBI

GenBank: M35140.1

Using Reverse Translation Tools: Sequence Manipulation Suite

• Validating the DNA sequence obtained by reverse translation from the amino acid sequence:
• The DNA sequence obtained by reverse translation generated the identical amino acid sequence of the protein listed in UniProt database.

3.3. Codon optimization

I am creating a yeast expression system for Histidine Ammonia-Lyase (HAT) production. The gene encoding the HAT enzyme will be sourced from Pseudomonas putida, the hutH gene. Since the efficiency of producing this protein will be strongly influenced by the host organism’s codon usage, the hutH DNA sequence should be optimized for codon usage in yeast. I used the IDT’s codon optimization tool to generate the codon-optimized DNA sequence.

Codon-optimized DNA sequence of the P. putida hutH gene.

3.4. You have a sequence! Now what?

I plan to use a cell-dependent method to express and purify the Histidine Ammonia Lyase (HAT) enzyme. The host organism, yeast, uses its DNA replication, transcription, and translation systems to make more copies of the DNA on the expression plasmid. While the DNA is copied, the transcription and translation system decodes the DNA to make proteins. Depending on the copy size of the expression plasmid, we expect more proteins to be produced from a self-replicating plasmid in cells, increasing the production yield. The expression system targets the enzyme to be exported outside of cells, creating more efficient downstream processing.

PART 4

Prepare a Twist DNA Synthesis Order

4.1. Create a Twist account and a Benchling account

4.2. Build Your DNA Insert Sequence

I am using a yeast expression vector from Twist Bio, pTwist_PIC9.

Features in the pTwist_PIC9 vector:

AOX1 promoter, methanol-inducible

Alpha-factor secretion signal sequence, which contains its translation initiation signal, Kozak-like sequence, and the initiation codon (ATG)

AOX1terminator

The insert sequence: the codon-optimized hutH gene from P. putida:

• The initiation codon (ATG) is removed due to the existing initiation codon in the alpha factor secretion sequence.
• Unique restriction enzyme sites added: SnaBI (TACGTA) at the N-terminus for in-frame cloning with the alpha-factor secretion signal sequence and NotI (GCGGCCGC) at the C-terminus.
• 7x His Tag is added at the C-terminus site: CATCACCATCACCATCATCAC (provided for a proof-of-concept)
• Stop codon is added: TAA

Linear Map of the final expression plasmid: pTwist_PIC9_hutH_histag

Benchling link:

https://benchling.com/s/seq-y5m2rFDiWbhGhUTuNVsT?m=slm-xuufMLauQwcB80ujHEx6

PART 5

DNA/Read/Write/Edit

5.1 DNA Read

What DNA would you want to sequence (e.g., read) and why?

I want to read the DNA from the human skin microbiome and compare it with healthy and diseased conditions. By doing so, it may be possible to figure out missing beneficial microbes in the disease condition. This could allow us to design probiotics that could help reverse disease conditions.

What technology or technologies would you use to perform sequencing on your DNA, and why?

I would most likely need to perform shotgun sequencing to capture all the DNA present on the skin by fragmenting and sequencing the individual fragmented DNA and later assembling the sequences by bioinformatics methods. Sequencing all DNA is the most comprehensive approach.

5.2 DNA Write

What DNA would you want to synthesize (e.g., write) and why?

What technology or technologies would you use to perform this DNA synthesis, and why?

5.3 DNA Edit

What DNA would you want to edit and why?

What technology or technologies would you use to perform these DNA edits, and why?

Week 3 HW: lab-automation

1. Create a Python file

• Generate an artistic design using the GUI at opentrons-art.rcdonovan.com
• Using the coordinates from the GUI, follow the instructions in the HTGAA26 Opentrons CoLab to write your own Python script that draws your design.

2. Find and briefly summarize a published paper that utilizes laboratory automation to achieve novel biological applications.

Paper

Kverneland, A., F. Harking, J. M. Vej-Nielsen, M. Huusfeldt, D. B. Bekker-Jensen, I. M. Svane, N. Bache, and J. V. Olsen. 2023. Fully automated workflow for integrated sample digestion and Evotip loading enabling high-throughput clinical proteomics. bioRxiv. https://www.biorxiv.org/content/10.1101/2023.12.22.573056v1

General Overview

Identification and quantification of proteins are important in biomarker discovery in clinical applications. Speed and sensitivity are bottlenecks for large cohort studies. Reliable sample preparation is highly critical for accurate and reproducible measurements in the LC-MS/MS platforms. Manual sample preparations are labor-intensive and prone to errors. For success in proteomics applications, a workflow with scalable and high-throughput sample preparation is essential.

The paper describes an automated, hands-free, end-to-end proteomics sample preparation workflow on the Opentrons OT-2 platform. They demonstrated magnetic bead-based protein aggregate capture and digestion and automated loading of the digested peptides, followed by desalting and sample storage, with reproducible results. The process applies to 96 samples in parallel and takes less than 6 hours.

Findings

The authors evaluated the performance of the automated workflow by using HeLa cell lysate, a well-established standard in LC-MS/MS-based proteomics, as a quality control. Using only 1 ug total protein, they were able to quantify about 50,000 peptides and 5600 proteins. Sample loss was negligible compared to the workflow ran by 15-fold higher sample input.

Replicates of workflows were comparable among quantified peptides and proteins, demonstrating reproducible protein quantification. Additionally, they tested the workflow with a larger sample set requiring sample storage between runs. Sample storage did not impact the number of quantified peptides. Plasma proteome was also evaluated, including samples from a clinical setting, a set of patients responding to therapy, and non-responding patients. Findings indicated the utility of the automated workflow in biomarker discovery.

Relevant Figures

Fig 1A. Schematic overview of the integrated workflow on Opentrons OT-2 robot.

Fig 5D. Application in clinical cohort of metastatic melanoma patients; Volcano plot comparing the time points (after CPI – before CPI) within responding and non-responding patients. CPI: Checkpoint Inhibitor Therapy.

3. Write a description of what you intend to do with automation tools for your final project.

Of the three possible final projects, Project 2 and Project 3, both use automation tools and are described in more detail under “Final Project Ideas”.

Automation tools can be used in the following ways in these projects:

Project 2 has a formulation step where a complex group of chemicals can be determined at their optimal concentrations with automated high-throughput testing in the downstream immunoassays.

Project 3 has an enrichment step to find high-affinity aptamers. High-throughput automation tools can be applied during performing microfluidic-based, microtiter-based, or magnetic bead-based screening and high-throughput sequencing.

Final Project Ideas

Project 1

The development of an engineered bacterial biosensor for real-time hydration detection as a preventive health measure in aging populations.

An engineered skin bacterium, applied as a lotion on the wrist or forearm, could detect body hydration levels and generate an electric current detectable by an electronic wearable component.

Overview:

• Select a reference strain from the human skin microbiome (i.e., Acinetobacter sp) as a chassis for the bacterial biosensor. Ideally, a Gram-negative species that functions to generate electric currency through a synthetic electron transport chain.
• Engineer the commensal strain to be dependent on non-canonical amino acids for growth for biocontainment purposes.
• Build a genetic circuit with an osmolarity-responsive promoter, ProU, from Escherichia coli that drives the expression of synthetic electron chain transport from Shewanella oneidensis, the CymA-Mtr pathway, which generates electron flow in response to an increase in sodium levels in the skin’s interstitial fluid.
• Detection of electron flow by a wearable component.

References:

Kim, S-R., Y. Zhan, N. Davis, S. Bellamkonda, L. Gillan, E. Hakola, J. Hiltunen, and A. Javey. 2025. Electrodermal activity as a proxy for sweat rate monitoring during physical and mental activities. Nature Electronics. https://doi.org/10.1038/s41928-025-01365-7

Rashid, F-Z. M., F. G. E. Cremazy, A. Hofmann, D. Forrest, D. C. Grainger, D. W. Heermann, and R. T. Dame. 2023. The environmentally-regulated interplay between three-dimensional chromatin organization and transcription of proVWX in E. coli. Nature Communications. https://doi.org/10.1038/s41467-023-43322-y

Atkinson, J. T., L. Su, X. Zhang, G. N. Bennett, J. J. Silberg, and C. M. Ajo-Franklin. 2022. Real-time bioelectronic sensing of environmental contaminants. Nature. https://doi.org/10.1038/s41586-022-05356-y

Project 2

Topical application of trans-urocanic acid (trans-UCA) for the management of atopic dermatitis (AD), a common skin disease in eczema patients.

Skin barrier dysfunction is the major contributor to eczema pathologies. To repair skin barrier dysfunction, trans-UCA, which is naturally found in healthy skin, is applied topically as a therapeutic.

Overview:

• Create a yeast expression system to produce the catalyst, histidine ammonia-lyase, a single enzyme required for trans-UCA synthesis.
• Purify and recover the catalyst from yeast fermentation.
• Establish a cell-free system for the production of trans-UCA.
• Apply an automation system to formulate, optimize, and perform efficacy measurements in a 3D reconstructed human epidermis (RHE) in the AD-induced model. The output is the multiplexed immunoassays to look for upregulation of filaggrin and reduction in cytokine markers, such as IL-1alpha.
• Below is the list of formulation components, which is extensive, and an automation platform is highly advantageous to optimally formulate the skin therapeutic.

1. Active pharmaceutical ingredient (API): trans-UCA
2. Buffer
3. Carrier system decision: oil-in-water, hydrogel, ointment
4. Surfactant/Emulsifier system
5. Penetration enhancers
6. Preservatives for shelf life
7. Antioxidants & light stabilizers
8. Other barrier repair components

References:

Peltonen, J. M., L. Pylkkanen, C. T. Jansen, I. Volanen, T. Lehtinen, J. K. Laihia, and L. Leino. 2014. Three randomized phase 1/IIa trials if 5 % cis-urocanic acid emulsion cream in healthy adult subjects and in patients with atopic dermatitis. Acta Derm Venereol. https://doi.org/10.2340/00015555-1735

Debinska, A. 2021. New treatments for atopic dermatitis targeting skin barrier repair via the regulation of FLG expression. J. of Clinical Medicine. https://doi.org/10.3390/jcm10112506

Kim, Y. and KM Lim. 2021. Skin barrier dysfunction and filaggrin. Arch. Pharm. Res. https://doi.org/10.1007/s12272-021-01305-x

Hernandez D. and A. T. Phillips. 1993. Purification and characterization of Pseudomonas putida histidine ammonia-lyase expressed in Escherichia coli. Protein Expression and Purification. https://doi.org/10.1006/prep.1993.1062

Le Pham, D., K-M. Lim, K-M. J., H-S. Park, D. Y. M. Leung, and Y-M. Ye. 2017. Increased cis-to-trans urocanic acid ratio in the skin of chronic spontaneous urticaria patients. Sci. Rep. https://www.nature.com/articles/s41598-017-01487-9

Project 3

A minimally invasive microneedle array with aptasensor technology to detect ferritin from the skin’s interstitial fluid for the body’s iron status and health monitoring.

A vegetarian and vegan diet can be iron-limited. A simple and less invasive device capable of continuous monitoring of the body’s iron storage would be helpful for individualized optimal diet adjustments.

Overview:

• Establish a random ssDNA library.
• Purify human ferritin protein in iron-loaded form as found in the skin’s interstitial fluid.
• Perform selection of functional oligonucleotides for high-affinity binding to the purified ferritin protein through Systemic Evolution of Ligands by Exponential enrichment (SELEX) technique.
• Use a microneedle with a gold-coated surface that will serve as the electrode.
• Engineer the candidate aptamer for electrochemical signal integration: 5’ end of the aptamer is made to contain an electrode attachment tag, such as Thiol, and the 3’ end to contain a redox tag such as Methylene Blue. Optimize to include a hairpin structure for ferritin binding stability.
• Detection of electron flow in a wearable device.

References:

Li, X., S. Liu, X. Huang, C. Yao, J. Chen, L. Gao, C. Zhou, Y. Wu, J. Liu, M. Li, N. Zhao, H-J. Chen, S. Huang, and X. Xie. 2025. Aptamers-based wearable electrochemical sensors for continuous monitoring of biomarkers in vivo. Microsystems & Nanoengineering. https://doi.org/10.1038/s41378-025-00993-5

Samant, P., M. M. Niedzwiecki, N. Raviele, V. Tran, J. Mena-Lapaix, D. I. Walker, E. I. Felner, D. P. Jones, G. W. Miller, and M. R. Prausnitz. 2020. Sampling interstitial fluid from human skin using a microneedle patch. Sci Transl. Med. https://www.science.org/doi/10.1126/scitranslmed.aaw0285

Kim, S-E., K-Y. Ahn, J-S. Park, K. R. Kim, K. E. Lee, S-S. Han, and J. Lee. 2011. Fluorescent ferritin nanoparticles and application to the aptamer sensor. Anal. Chem. https://pubs.acs.org/doi/10.1021/ac200657s

Week 1 Lab: Pipetting

Individual Final Project

Group Final Project