https://pages.htgaa.org/2026b/dakota-hamill/index.htmlAbout me I am a PhD student with an interest in biotech startups, natural products, DIYBio, and Actinomycetes Contact info Homework, Labs, and Projects See the nav bar on the left to look through my work for How To Biomanufacture Almost Anything (Fall 2026)!Hugoenhttps://pages.htgaa.org/2026b/dakota-hamill/week-01-hw-project-ideas/index.htmlMon, 01 Jan 0001 00:00:00 +0000https://pages.htgaa.org/2026b/dakota-hamill/week-01-hw-project-ideas/index.html(1) WHAT WOULD YOU LIKE TO BIOMANUFACTURE AND WHY? Project Proposal: Towards New Pickaxes - Improving rare earth element (REE) capture in biomining I want to create a library of molecular “pickaxes and shovels” that are proteins with ultra-high specificity for capturing valuable rare Earth elements. This project will expand upon the current knowledge of Lanmodulin (LanM), a Methylobacterium extorquens metal binding protein with 100 million fold specificity for Ln3+ (Lanthanides) ions over Ca2+ ions.https://pages.htgaa.org/2026b/dakota-hamill/week-02-hw-dna-design/index.htmlMon, 01 Jan 0001 00:00:00 +0000https://pages.htgaa.org/2026b/dakota-hamill/week-02-hw-dna-design/index.htmlWhat molecule are you expressing? Lanmodulin, a protein. What is the sequence? ENA|ACS39628|ACS39628.1 Methylorubrum extorquens AM1 conserved hypothetical protein; putative exported protein ATGGCGTTCCGCCTCTCCTCTGCCGTTCTGCTCGCTGCGCTCGTCGCCGCTCCGGCCTAC GCCGCCCCGACGACGACCACGAAGGTCGATATCGCCGCCTTCGATCCGGACAAGGACGGC ACGATCGATCTGAAGGAGGCCCTGGCCGCCGGCTCCGCTGCCTTCGACAAGCTCGATCCG GATAAGGACGGCACGCTCGACGCTAAGGAGCTGAAGGGCCGCGTCAGCGAGGCCGACCTC AAGAAGCTCGACCCGGACAACGACGGCACCCTCGACAAGAAGGAATACCTTGCCGCCGTC GAGGCGCAGTTCAAGGCCGCTAACCCGGACAACGACGGCACCATCGACGCTAGGGAATTG GCCAGCCCGGCCGGTTCGGCCCTGGTCAATCTGATCCGCTAA https://www.uniprot.org/uniprotkb/C5B164/publications What chassis? E. Coli BL21 (DE3) Where does the product need to go? Preferably secreted outside of the cell. Part 2: Design your genetic parts Part Name Vector pUC-AmpR v4 backbone Promoter T7 Promoter RBS F1 RBS CDS LanM Tag BBa_K2539001 HisTag Terminator T7 Terminator I chose parts with the most simple names. I found Kernel hard to use, confusing, and with a poor UI.https://pages.htgaa.org/2026b/dakota-hamill/week-03-hw-cell-free/index.htmlMon, 01 Jan 0001 00:00:00 +0000https://pages.htgaa.org/2026b/dakota-hamill/week-03-hw-cell-free/index.htmlA. COMPARE CELL-FREE REACTION COMPOSITIONS (20 minutes) Why does the concentration of potassium glutamate and magnesium glutamate differ between compositions? Which is more sensitive? Explain how a PEP+NTP reaction formulation is different from a Ribose+NMP reaction formulation. Choose two cell-free reaction compositions from the literature, compare and contrast the choice of reagents and the concentration of reagents. Note: A recommended starting point would be to review a least one published formulation, such as PANOx-SP (Jewett & Swartz 2004), a cost-optimized formulation from Olsen et al. (2026), and/or an AI-designed formulation from Smith et al. (2026).https://pages.htgaa.org/2026b/dakota-hamill/final-project/index.htmlMon, 01 Jan 0001 00:00:00 +0000https://pages.htgaa.org/2026b/dakota-hamill/final-project/index.html