Week 2 HW: DNA Design

What molecule are you expressing? Lanmodulin, a protein.

What is the sequence?

ENA|ACS39628|ACS39628.1 Methylorubrum extorquens AM1 conserved hypothetical protein; putative exported protein ATGGCGTTCCGCCTCTCCTCTGCCGTTCTGCTCGCTGCGCTCGTCGCCGCTCCGGCCTAC GCCGCCCCGACGACGACCACGAAGGTCGATATCGCCGCCTTCGATCCGGACAAGGACGGC ACGATCGATCTGAAGGAGGCCCTGGCCGCCGGCTCCGCTGCCTTCGACAAGCTCGATCCG GATAAGGACGGCACGCTCGACGCTAAGGAGCTGAAGGGCCGCGTCAGCGAGGCCGACCTC AAGAAGCTCGACCCGGACAACGACGGCACCCTCGACAAGAAGGAATACCTTGCCGCCGTC GAGGCGCAGTTCAAGGCCGCTAACCCGGACAACGACGGCACCATCGACGCTAGGGAATTG GCCAGCCCGGCCGGTTCGGCCCTGGTCAATCTGATCCGCTAA

https://www.uniprot.org/uniprotkb/C5B164/publications

What chassis? E. Coli BL21 (DE3)

Where does the product need to go? Preferably secreted outside of the cell.

Part 2: Design your genetic parts

I chose parts with the most simple names. I found Kernel hard to use, confusing, and with a poor UI.

Part 3: Assemble your construct

Part 4: Optimize and quality-check

• Codon-optimize

  

• Biosafety

I found kernel non-intuitive and confusing. It was difficult to even figure out how to copy DNA sequences from the construct to paste into the tools. The tools rarely worked and gave errors. Not sure why my CDS was optimized for chinese hamster cells.

Searching parts was also difficult, 99% are given as BBa_ IGem parts with no clear description of what they do without going down multiple menu clicks, which when I did for one, gave an error/file not found on the iGem repoistory for what the part did anyway.

Part 5: From design to build

• How would you build it? Order the 402nt sequence for LanM (Lanmodulin) directly from a DNA synthesis company and probably have them put it into a high-copy number plasmid with antibiotic selection.
• What does synthesis constrain? I don’t believe the CDS has anything difficult, but unsure how to add a His-tag
• Prototype vs scale? I’d simply like to get it in a plasmid and do a transformation and see if the protein is made. No need to scale yet, just see if I can get LanM expressed in E. coli

Part 6: What don’t you know yet?

Biggest unknowns are if the protein will fold in E. coli, how to codon optimize it from M. extorquens to E. coli, and how to tag the protein to force it outside into the fermentation supernatant, and not keep it intracellular.

Once it’s on a plasmid and cloned into E. coli, we could run a western blot on a cell free supernatant and lysed cell pellet to see where the highest concentration of the protein is.