Week 2 HW: DNA Design

HTBAA Homework #2

Project: Recombinant AmGH110A for ex vivo removal of the group B antigen.

Part 0: Set up in Kernel

I created the repository HW2_Gabriela Vera_AmGH110A and the folder vera-amgh110a in the course workspace.

Part 1: Define your expression target

What molecule are you expressing?

I selected AmGH110A, an α-(1,3)-galactosidase from Akkermansia muciniphila associated with removal of the canonical group B antigen from red blood cells (Jensen et al., 2024).

What is the sequence?

The target is gene Amuc_0480 (glaB), corresponding to protein records GenPept ACD04318.1 and UniProtKB B2UNU8; my native coding sequence was derived from NCBI genome accession CP001071.1. The saved CDS is 2,385 bp including its terminal TAA codon and encodes 794 amino acids.

Sequence: ATGGAAGGCAATCTCTCTTTTTCTCTGATGGAAGCTTCTGGACGATCCATATTTTTTCTGATAGAAGGAA TACGGGAACAGAGTATAAAAAATATGTTCAGCCGGATGTTTTCATGGAGTTTTGTAGTTGCAGCGTGTTT GGCGGGATTATTCCCGGCACAGTCCCAGGGCGAGGAAAAAGCTGCCCAATCCGGAACCATAGCCGTAAAA GTTCCTGCCTCCAGCCTGCTGATGACTCGCCAGGAGACGGGGGAAACCCGGTTGGACCGGTCTTTCAGTA ATGCGGGGTTGAGCATAGGCGGCAAAAAATATGCCACGGGAATCGGTACGCACGCTACGTCCATGATTCC CCTGCCCGTTCCGGAAAACCCGAAAGTTTTGAGGCTGGAAGGTGCATGCGGAATTGATGACGGTGCGGAT GGAGACGGAAGCGTGGAATTCCGCGTGATGAGCGGGTCCGAGGTTTTATGGAGTTCCGGCGTGATGAGGA GGGGGATGGCCGCGAAGAAGTTTTCCATTCCGGTGGCGGAAAACGGCATACGGCATCTTTACCTGATGGC CGACCGGGTGGACAATAATTCTTACGACCATGCGGACTGGGTAGATCTGGCCTGGAAGACGACAGGAAGT GGGCAGGGGATGAAGGGAGCTGTGGTGAATGCCTCTGAATTCGGCATGGTTCCCGGCGTCAGAAAAGATC AGGGGCCGGCGCTGCGGGCTGCCGTTTCCGCTCTCCGGAGGCAGGGCGGGGGCGTTTTGAACATCCCCAG AGGCATTTACCATTTTTATCCGGAGGGGGCTTTGAACATGAGTTTCCATATTTCCAACCATGACCAGCCG CTGATTCATCCGGTGTGTGTGCCTCTGGCCGATTTGCGGAATGTCCGCGTGGAGGGCAATGGTTCCCTGT TTCTTTTTCACGGCAAGGTGGTTCCCCTCCTGGTGATGGACAGCGAAAATGTCAGCATCAACCGTTTATC CGTGGATTACGAACGGTCCTGGTGCACGGAGGCGCGCGTCGTGAAGACGGATGACCGGTTCACGGAAGTG GAAATAGACAAAAAGGCCTACCCTTACGAAATCCGGAACAACAGGTTCGTTTTCCAGGGGAAAGGCTGGG AAGAAGGAATGGGAAGCTGCATGGCCTTTGAGAAAGGGACGGGACATATTATCGCCAATACATCGGACAT CGGCTGGAACGGGCATGTGGAGCCGCTGGGCGGGAGCCGTCTCCGTCTGTCCTGGAACCTCAGGCAGAAG GGAATCAAGCCGGGGGATACGCTGGTTCTTCGGAATTATAACCGCCCCCATCCGGGATGCGTGGTGTACC GGGCTCGGAAAACATCACTGAATGACGTATCTCTGCACCAGAGCTCAGGCATGGCCCTGCTGGTCCAGCG ATCGGAGGACTTTCATATGAAAGGCGGCGGAGTCATGGTCAGGAAAGGCACAGGGCGCGTACACACCGCC GGAGCGGACGCAACCCATTTTTCCAATACCCGGGGCGGAATCGTGGTGGAGAAAGCCCTGTTCGAAGGGA TGATGGATGATGCCATCAATGTTCATTCCACCTGCCTGGGCGTGATGGAAGTAGTGGACAGCCATACCCT GAAGTGCAAATACATGCATCGGCAGGCGGTGGGGTTTGAGGTGTTTCTTCCCGGTGAAAAAATCCGTTTC ATCAACGGTCCTACGCTGGAACCCGGCGGAACGGCCACTGTGAAGACGGCAGTGAAAAAGAATTCCGCGG AGATGGTGATTACGGTGGAAGAGCCGCTCCCCTCCTCCGTCAGGGCCGGGGATGCCGTGGAGAATGCGGA TTTTTACCCTTCCGTGGTTTTCCGCAACAATATCGTCCGCAACAACCGTGCCAGAGGATCTCTTTTTACA ACGCCGGAGAGAGTGCTGGTGGAGGGCAATTTGTTTGACCATTCCTCCGGCTCCGCCATTCTATTGGCAG GGGATGCCCAGGGGTGGTATGAAAGCGGCGCCTGCCATGAAGTGGTGATCCGCAAAAATACATTCATTAA CAACCTGACCTCGCGTTACCAGTTTACGAATGCCATCATTTCCATTTACCCGGAAGTCAAGCAGCTGGAC AGGCAGAGGGATTACTATCATCGCAATGTGCTGATAGAAAATAATGTTTTCAAGACGTTCGATGTGCCGC TGCTGTTCGCCATTTCCACGGACAACCTCAAGTTCATCAATAATAAGGTCATTTACAATGACGAGTTTAA GGGATGGGGGCAGAAACCTTTCCAATTCAGAAGATGCGCCAATATTCTGATTAAAGATAACAAGGTGCTG CCTCCCCGCACATGGACCCTTGAGGACTGCAAGCTGGAAAATACCCCATCAGATCAGGTCCGCTTTGGTG GATAA

What host or chassis? The production host is E. coli BL21(DE3), as proposed in Homework 1

Where does the product need to go?

My goal is to produce AmGH110A in E. coli BL21(DE3), purify it, and use the purified enzyme to treat red blood cells ex vivo. The saved CDS retains a predicted signal peptide, so the enzyme’s location in the bacterial cells has not yet been confirmed.

Part 2: Design your genetic parts

No purification tag was added to this construct.

Part 3: Assemble your construct

In Kernel, I assembled pSB1C3 with the T7 promoter → Shine–Dalgarno RBS → native AmGH110A CDS → T7 terminator. The exported construct is 4,537 bp and is annotated as circular. The parts appear in the intended order and orientation on the Kernel map. The CDS has a start and terminal stop, but Kernel’s warning about its ending and the assembly junctions still need review.

Figure 1. Kernel schematic of the 4,537 bp pSB1C3–AmGH110A construct.

Part 4: Optimize and quality-check

Codon-optimize

I used Kernel to optimize the native AmGH110A CDS for expression in E. coli. The optimized sequence still encodes the same 794 amino acids, but 485 codons changed and its GC content decreased from 53.8% to 43.8%. It is 3 bp longer because Kernel added another stop codon. Codon choice can affect how efficiently E. coli produces the protein, although this result does not show whether the enzyme will be active. I saved the optimized sequence separately; the construct shown in this report still contains the native CDS. Figure 2. Kernel codon optimization output; full input and optimized sequences are in the CSV export

Search your sequence

I searched the 2,385 bp native AmGH110A CDS in Kernel. The strongest hits were my saved CDS and the CDS within my cassette, each showing 100% identity and full query coverage with E-value 0. Other library results were short partial matches. This confirms consistency among the objects I saved, but it is not an independent external identification of the enzyme. The original NCBI accession and Jensen et al. support the target assignment. Figure 3. Kernel sequence-search results for the native CDS

Run the safety screen

I submitted the full 4,537 bp construct, including pSB1C3 and the AmGH110A expression cassette, to the SecureDNA biosecurity sequence scanner. It reported “No flagged sequences detected.” This is a sequence-screening result, not a test of whether the enzyme will be expressed or active. Figure 4. SecureDNA biosecurity screen of the full 4,537 bp construct.

Part 5: From design to build

How would you build it?

For a prototype, I would order the 2,467 bp AmGH110A cassette as synthetic DNA and assemble it into a verified pSB1C3 backbone. I chose this approach because the cassette is a few kilobases long and already contains the expression elements. Gibson assembly can join DNA fragments with matching ends, but I would first need to confirm the backbone and design the correct junctions (Gibson et al., 2009). What does synthesis constrain?

DNA synthesis can introduce errors and may be difficult in regions with repeats or extreme GC content. I would review the full 4,537 bp sequence for these features and sequence the assembled plasmid to check for mistakes. If the cassette needed to be synthesized in smaller fragments, error correction could help before assembly (Carr et al., 2004).

Prototype vs. scale.

For a prototype, I would make and verify a small number of plasmids to test enzyme production. At a larger scale, the main need would be to produce and purify much more enzyme through fermentation. I would not need to synthesize a new plasmid for every unit of red blood cells.

Part 6: What don’t you know yet?

Are the final sequence and junctions correct?

I added pSB1C3 in Kernel, and the 4,537 bp GenBank export is annotated as circular. I would inspect both insertion junctions and resolve Kernel’s warning about the end of the CDS, then sequence the physical plasmid after assembly.

Will E. coli produce an active enzyme?

The saved CDS includes a predicted signal peptide, and I have not added a purification tag. I would compare the full-length protein with a version lacking the signal peptide, then measure how much soluble, active enzyme each produces. I would also test whether adding a His₆ tag helps with purification without affecting activity.

Is AmGH110A alone enough for the intended red-cell treatment?

I would test treated red blood cells for remaining B antigens. If antigens remain, I would investigate whether another enzyme is needed.

AI

I used ChatGPT by OpenAI to help me navigate some steps in Kernel, organize the information in this report, and improve the grammar and clarity of my writing. I also used it to explore another possible backbone after finding that adding my complete cassette to pET28a might duplicate expression elements. That search led me to select pSB1C3, which I added to my final construct in Kernel. Examples of questions I asked, paraphrased in English, were: “How should I interpret this Kernel result?”, “Would adding my complete expression cassette to pET28a duplicate any elements?”, “What alternative backbone could accommodate the cassette?”, and “How can I make this explanation clearer and more concise?” I reviewed the suggestions against my saved Kernel results and the cited sources. The final design choices and remaining uncertainties are my responsibility.

References

Jensen, M. et al. (2024). Akkermansia muciniphila exoglycosidases target extended blood group antigens to generate ABO-universal blood. Nature Microbiology, 9, 1176–1188. https://doi.org/10.1038/s41564-024-01663-4

Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6, 343–345 (2009). https://doi.org/10.1038/nmeth.1318

Carr, P. A. et al. Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Research 32, e162 (2004). https://doi.org/10.1093/nar/gnh160

NCBI GenBank. Akkermansia muciniphila ATCC BAA-835, complete genome. Accession CP001071.1. https://www.ncbi.nlm.nih.gov/nuccore/CP001071.1

UniProtKB. Alpha-(1,3)-galactosidase B (glaB, Amuc_0480), accession B2UNU8. https://www.uniprot.org/uniprotkb/B2UNU8/entry

SnapGene. pSB1C3 sequence and map. https://www.snapgene.com/plasmids/basic_cloning_vectors/pSB1C3