Week 1 HW: Final Project Ideas

Biomanufacturing Programmable Platform for mRNA Therapeutics

(1) What you would like to biomanufacture and why?

I want to biomanufacture a programmable platform that can rapidly produce mRNA therapeutics.

The idea is to combine the components of a living system/chassis with laboratory automation and computational design. Instead of building a manufacturing process around one fixed RNA drug, I want to create a flexible platform where a new therapeutic RNA sequence can be designed, manufactured, tested, and optimized with minimal manual intervention.

My target product is a purified mRNA therapeutic/manufacturing cassette. mRNA is a molecule that carries genetic instructions that cells can use to produce a particular protein. In an mRNA therapeutic, the RNA is designed so that, after it reaches the appropriate cells, the cells can temporarily produce the desired protein. mRNA technology has emerged as a cornerstone in vaccine development and therapeutic applications, offering key benefits such as high potency, rapid scalability, and cost-effectiveness. The success of COVID-19 mRNA vaccines has underscored their efficacy and safety. However, residual byproducts generated during mRNA synthesis, such as unincorporated caps, nucleoside triphosphates (NTPs), DNA templates, enzymes, abortive transcripts, and double-stranded RNA (dsRNA), pose significant challenges to the clinical application of the RNA therapy.

For this project, I would like to develop a manufacturing platform capable of producing many different mRNA products. The platform could theoretically be adapted to manufacture:

• therapeutic proteins
• vaccine antigens
• cancer-related therapeutic RNAs
• RNA used in cell-therapy workflows
• other experimental RNA medicines

The important feature is that the manufacturing infrastructure would remain largely the same while the RNA sequence could change. I want to develop a project in connection between gene therapies, RNA therapies, cell therapies, synthetic biology, and automation.

(2) What living system would you use?

For this project, I would use a cell-free enzymatic manufacturing system as the primary production chassis. The system would contain the biological machinery necessary to synthesize RNA without requiring a living microorganism or mammalian cell to grow.

The DNA template provides the information for the desired RNA sequence. Enzymatic machinery then uses that template to synthesize RNA. The inputs would include:

• a DNA template containing the desired RNA sequence
• transcription enzymes
• nucleotides
• appropriate reaction components
• other materials needed for RNA synthesis and stabilization

The biological machinery reads the DNA template and synthesizes an RNA molecule with the desired sequence. The resulting material would then go through purification and quality-control steps. The anticipated output would be purified mRNA suitable for further development and testing. The idea to integrate automated manufacturing with computational optimization to create a flexible, self-improving RNA manufacturing platform. The system would have four major components:

1. A computer model would propose RNA designs based on the desired biological function and manufacturing requirements
2. A liquid-handling robot or cloud laboratory would automatically prepare and run small-scale production experiments
3. The resulting RNA would be analyzed for properties such as quantity, integrity, and consistency
4. The experimental results would be fed back into the computational model.

The cycle would therefore be: Design → Build → Test → Learn → Redesign

Instead of optimizing one RNA product manually, the system would continuously learn from its experimental results. The idea is to develop a programmable, automated RNA manufacturing platform in which the same infrastructure can manufacture different RNA sequences and use experimental data to continuously improve both the RNA design and the manufacturing process. The goal is to make the manufacturing process itself programmable.

(3) How would you use automation?

I would like to use cloud laboratory or opentrons for automation which could help in:

• reaction setup
• liquid transfers
• preparation of experimental conditions
• sample collection
• organization of experimental data
• preparation of multiple RNA designs in parallel Instead of manually producing one RNA design at a time, I could test many designs simultaneously.

(4) How much would you need to make, and how long would it take?

(a) How much?

Suppose if I am manufacturing mRNA for 1000 hypothetical patients and each patient requires 1 mg of purified mRNA Therefore: 1 mg for each patient, 1000mg for 1000 patients (1 x 1000) = 1 gm of purified mRNA for 1000 patients. Suppose my cell-free manufacturing process eventually achieves an average usable RNA production concentration of: 2 mg/mL Then production volume required would be 500 mL.

Suppose I get 70% recovery, so for 100mg of manufactured mRNA, I will get 70mg of purified mRNA. Given the above, I will need 1000mg purified mRNA for 1000 patients. Hence, X x 0.70 (70%) = 1000mg X = 1000/0.70 = 1428.57mg, so approx. 1429mg
= 1429 x 1 by 2 = 714.5 mL approx. 715 mL

(b) How long?

Suppose each automated production unit can process 100mL per run, then we would need approximately 715mL Hence, 715mL/1000mL = 7.15 run= 8 runs. If we run 1 cycle per day then for 8 runs, 8 days

(5) What don’t you know yet?

Major technical unknowns: Can the system produce enough high-quality mRNA?

My calculation assumes a production concentration of 2 mg/mL, but this is only an engineering assumption. The actual usable yield could be significantly higher or lower. I would need experimental measurements of:

• RNA yield
• RNA integrity
• purification recovery
• batch-to-batch consistency (before I could make a reliable manufacturing estimate)

Can the automated system make the system reproducible?

A manufacturing system needs to reproduce that result repeatedly, will this system be able to continuosuly make mRNA therapeutics?

Please also cite your AI client and prompts. OpenAI ChatGPT (GPT-5.6 Luna) Prompts:

• Suggest different platforms for biomanufacturing of mRNA therapeutics and what kind of automated systems help develop these
• Help me calculate how much mRNA needs to be manufactured for 1,000 hypothetical patients if each patient requires 1 mg of purified mRNA. Assume a 70% purification recovery, a production concentration of 2 mg/mL, a 100 mL capacity per automated manufacturing run, and 1 day per run

Week 2 HW: DNA Design

##Part 0: Set up in Kernel## Repository name: Gargi Project name: Deshmukh_mRNA biomanufacturing

##Part 1: Define your expression target##

I want to design a DNA construct to transcribe mRNA of Chandipura virus (CHPV) glycoprotein G. Chandipura virus is an emerging viral pathogen associated with encephalitic disease, particularly affecting children in parts of India. The viral glycoprotein G is an envelope protein involved in viral attachment and entry and is therefore an important antigenic component of the virus.

###Sequence:###

Chandipura virus isolate 1015405 glycoprotein (G) gene, complete cds GenBank: KY321565.1

ATGACTTCTTCAGTGACAATTAGTGTGATCCTTCTTATCTCCTTTATTACCCCATCATACTCATCTTTGAGTATAGCATTTCCAGAAAACACCAAATTAGATTGGAAGCCAGTCACAAAAAATACTAGATACTGCCCTATGGGTGGGGAATGGTTTCTAGAACCAGGGTTACAAGAAGAATCTTTCTTGAGCTCTACACCAATTGGTGCGACCCCCTCCAAGTCAGATGGATTTCTCTGTCATGCAGCCAAGTGGGTGACGACATGTGATTTCAGATGGTATGGACCCAAATATATTACACATTCAATTCATAATATCAAACCTACCCGATCAGATTGTGATACAGCGCTTGCATCGTACAAATCCGGGACATTGGTGAGCCCTGGTTTTCCCCCAGAGTCTTGTGGTTATGCTTCTGTGACTGACTCCGAGTTCTTGGTGATCATGATTACTCCTCATCACGTAGGTGTGGATGACTACAGAGGACATTGGGTAGATCCTCTTTTTGTTGGAGGAGAATGCGACCAGTCTTATTGTGATACTATCCACAACTCCTCAGTTTGGATTCCTGCTGATCAGACTAAGAAGAACATTTGCGGCCAGTCCTTTACCCCGCTGACTGTGACGGTTGCCTATGATAAAACCAAAGAAATCGCTGCAGGCGCACTAGTCTTTAAGAGCAAATATCACTCTCACATGGAAGGTGCTCGAACTTGCAGATTGAGTTATTGCGGTAGGAACGGAATTAAATTCCCCAATGGAGAGTGGGTCAGCCTGGATGTTAAAACTAAGATCCAAGAGAAACCTTTACTTCCCTTGTTTAAAGAGTGTCCTGCCGGGACAGAGGTGAGATCTACTCTTCAATCCGATGGGGCTCAAGTCTTGACCTCGGAGATTCAGAGGATTTTGGATTATTCCTTGTGTCAGAACACGTGGGATAAGGTAGAACGCAAAGAGCCGTTGTCTCCATTAGATCTCAGCTATTTGGCATCTAAATCTCCGGGGAAAGGTCTGGCATATACAGTGATAAATGGGACATTGTCATTTGCCCATACCAGATATGTGAGGATGTGGATTGATGGCCCGGTGTTGAAAGAAATGAAAGGCAAAAGGGAATCTCCTAGTGGGATCTCGAGTGATATTTGGACCCAATGGTTCAAATACGGGGATATGGAGATAGGTCCAAACGGCCTCTTAAAGACAGCAGGAGGGTACAAATTCCCCTGGCATCTGATCGGTATGGGAATTGTTGACAATGAACTACACGAGCTCAGTGAGGCAAACCCTTTAGACCATCCACAGCTACCTCATGCTCAGTCTATTGCCGACGATTCGGAGGAGATCTTCTTTGGAGACACTGGGGTTTCCAAGAATCCAGTAGAACTGGTTACAGGGTGGTTCACTAGCTGGAAAGAGAGCTTAGCTGCCGGTGTTGTTTTGATACTGGTAGTTGTCTTGATTTATGGTGTCCTCCGTTGTTTCCCGGTATTGTGTACTACCTGCAGAAAGCCCAAATGGAAGAAAGGGGTAGAGAGGTCCGATAGCTTTGAGATGCGGATTTTCAAGCCCAACAACATGAGAGCCAGAGTATGA

###Chassis:*** Cell-free system

###Where does the product need to go?### The product is purified CHPV-G mRNA obtained via in-vitriol transcription , however once it is translated inside a cell, it will make CHPV glycoprotein G.

CHPV-G is an envelope glycoprotein with protein-targeting and membrane-associated features. These features are encoded within the protein-coding region rather than being part of the mRNA’s UTRs.

Final Project