Week 2 HW: DNA Design

Part 0: Set up in Kernel

Repository and folder name are both “qian-project” until I think of a name for my project.

Part 1: Define your expression target

What molecule are you expressing? A protein, an RNA, or an enzyme (or small set of enzymes) for a pathway. If your HW1 product is a material, food, or chemical, identify the protein(s) that produce it and design for those.

Ultimately, I am expressing a bioluminescent protein, such as luciferase from V. fischeri, which is made of two subunits, LuxA and LuxB. I would also have to express regulatory proteins to ensure that this protein is only expressed/active at low light levels. I will also express LEVI, a fusion protein of blue-light-sensitive VIVID from N. crassa and DNA-binding domain of LexA repressor from E. coli, which will repress the expression of luciferase in low light. The fact that the LexA portion if from E. coli, because that way it binds a different sequence than the native B. subtilis LexA, so there is little chance of the E. coli LexA binding off target.

What is the sequence? Give the protein or RNA sequence, or the specific gene, you will encode, and say where it comes from (a database accession such as UniProt or NCBI, a known part, or de novo). Cite it.

From UniProt:
Nucleotide sequeces obtained using Twist Biosciences’ reverse translator and codon optimizer. Optimized for B. subtilis.

LuxA from V. fischeri:

• Accession: P19907
• Amino acid sequence: MKFGNICFSYQPPGETHKLSNGSLCSAWYRLRRVGFDTYWTLEHHFTEFGLTGNLFVAAANLLGRTKTLNVGTMGVVIPTAHPVRQLEDVLLLDQMSKGRFNFGTVRGLYHKDFRVFGVDMEESRAITQNFYQMIMESLQTGTISSDSDYIQFPKVDVYPKVYSKNVPTCMTAESASTTEWLAIQGLPMVLSWIIGTNEKKAQMELYNEIATEYGHDISKIDHCMTYICSVDDDAQKAQDVCREFLKNWYDSYVNATNIFNDSNQTRGYDYHKGQWRDFVLQGHTNTNRRVDYSNGINPVGTPEQCIEIIQRDIDATGITNITCGFEANGTEDEIIASMRRFMTQVAPFLKEPK
• Nucleotide sequence: ATGAAATTTGGAAATATTTGCTTTTCTTATCAGCCGCCGGGAGAAACACATAAACTTAGCAACGGAAGCCTTTGCTCTGCGTGGTACCGGCTGCGCAGAGTCGGCTTTGATACATATTGGACACTTGAGCATCACTTTACAGAGTTTGGATTAACAGGAAACCTTTTTGTAGCGGCGGCGAACCTTCTTGGCAGAACAAAAACACTGAATGTAGGAACAATGGGCGTTGTGATTCCGACAGCGCATCCGGTCCGCCAGCTTGAAGATGTGCTTCTTCTTGATCAAATGAGCAAAGGCCGCTTCAACTTCGGCACAGTGCGCGGCCTTTATCACAAAGATTTCCGCGTGTTCGGTGTAGATATGGAAGAAAGCCGCGCGATCACACAAAACTTCTATCAAATGATCATGGAAAGCCTGCAAACAGGCACAATCTCATCAGACTCTGATTATATCCAGTTCCCGAAAGTAGATGTATATCCGAAAGTGTATTCCAAAAACGTGCCGACATGCATGACAGCGGAATCTGCAAGCACAACAGAATGGCTTGCGATCCAAGGCCTTCCGATGGTGCTTTCTTGGATTATCGGCACAAATGAAAAAAAAGCGCAGATGGAGCTTTATAACGAAATCGCAACAGAATATGGCCATGATATCAGCAAAATTGATCACTGCATGACATACATCTGCTCTGTAGATGATGATGCGCAGAAAGCGCAAGATGTCTGCCGTGAGTTCCTGAAAAACTGGTATGACTCTTATGTAAATGCGACAAACATCTTCAATGATAGCAACCAAACACGCGGATATGATTATCATAAAGGCCAGTGGAGAGATTTTGTGCTTCAAGGCCACACAAATACAAACCGCCGCGTTGATTACAGCAACGGAATCAATCCGGTCGGAACACCGGAACAATGCATTGAAATCATTCAGAGAGACATTGATGCGACAGGAATCACAAATATCACATGCGGCTTTGAAGCAAACGGAACAGAAGATGAAATCATTGCTTCTATGCGCAGATTTATGACACAAGTTGCGCCGTTCTTAAAAGAGCCGAAA

LuxB from V. fischeri:

• Accession: P19908
• Amino acid sequence: MKFGLFFLNFQKDGITSEETLDNMVKTVTLIDSTKYHFNTAFVNEHHFSKNGIVGAPITAAGFLLGLTNKLHIGSLNQVITTHHPVRVAEEASLLDQMSEGRFILGFSDCESDFEMEFFRRHISSRQQQFEACYEIINDALTTGYCHPQNDFYDFPKVSINPHCYSENGPKQYVSATSKEVVMWAAKKALPLTFKWEDNLETKERYAILYNKTAQQYGIDISDVDHQLTVIANLNADRSTAQEEVREYLKDYITETYPQMDRDEKINCIIEENAVGSHDDYYESTKLAVEKTGSKNILLSFESMSDIKDVKDIIDMLNQKIEMNLP
• Nucleotide sequence: ATGAAATTTGGATTATTTTTTTTAAATTTTCAAAAAGACGGAATCACATCAGAAGAAACACTTGATAACATGGTAAAAACAGTAACACTTATTGACAGCACAAAATATCACTTTAATACAGCGTTTGTAAATGAGCATCATTTCAGCAAAAACGGCATTGTCGGCGCGCCGATCACAGCTGCAGGCTTCCTTCTTGGATTAACAAACAAACTTCATATCGGCTCTTTAAACCAAGTAATCACAACACACCACCCGGTGCGCGTAGCGGAAGAAGCGTCTCTTCTTGATCAGATGTCTGAAGGCCGCTTTATTCTTGGCTTCTCTGACTGCGAAAGCGATTTTGAAATGGAGTTCTTCCGCCGCCATATCTCAAGCCGCCAGCAGCAGTTTGAAGCGTGCTATGAAATCATCAATGATGCGTTAACAACAGGCTACTGCCACCCGCAAAATGATTTCTATGATTTCCCGAAAGTATCTATCAACCCGCACTGCTATTCTGAAAACGGCCCGAAACAGTATGTCTCTGCAACAAGCAAAGAAGTTGTTATGTGGGCGGCGAAAAAAGCGCTTCCGTTAACATTTAAATGGGAAGATAACCTTGAAACAAAAGAGCGCTATGCGATTCTTTACAACAAAACAGCGCAGCAGTACGGCATTGATATCTCTGATGTAGATCACCAGCTTACAGTGATTGCAAATTTAAATGCTGACCGCAGCACAGCGCAGGAAGAAGTGCGCGAATATCTGAAAGATTATATCACAGAAACATATCCGCAAATGGATCGTGATGAAAAAATCAACTGCATTATTGAAGAAAATGCGGTCGGAAGCCATGATGATTATTATGAAAGCACAAAACTTGCGGTTGAAAAAACAGGAAGCAAAAACATCTTACTTTCTTTTGAAAGCATGAGCGATATCAAAGATGTCAAAGACATCATTGATATGTTAAACCAAAAAATTGAAATGAATCTTCCG

From Chen et al. 2016:
LEVI:

• Amino acid sequence: MKALTARQQEVFDLIRDHISQTGMPPTRAEIAQRLGFRSASSAEEHLKALARKGVIEIVSGASRGIRLLQEEEEGLPLVGRVAAGEPHTLYAPGGYDIMGYLIQIMKRPNPQVELGPVDTSVALILCDLKQKDTPIVYASEAFLYMTGYSNAEVLGRNCRFLQSPDGMVKPKSTRKYVDSNTINTMRKAIDRNAEVQVEVVNFKKNGQRFVNFLTMIPVRDETGEYRYSMGFQCETE
• Nucleotide sequence: ATGAAAGCATTAACAGCAAGACAACAAGAAGTTTTTGATTTAATCAGAGATCACATCAGCCAAACAGGAATGCCGCCGACACGCGCGGAAATTGCGCAGAGATTAGGCTTCCGCAGCGCATCTTCTGCTGAAGAGCATTTAAAAGCGCTTGCGAGAAAAGGCGTCATTGAAATTGTTAGCGGAGCAAGCCGCGGAATTCGCCTTCTTCAAGAAGAAGAAGAAGGCCTGCCGCTTGTCGGCCGCGTTGCGGCAGGAGAGCCGCACACACTTTATGCGCCGGGCGGCTATGATATCATGGGCTATTTAATTCAAATTATGAAACGCCCGAACCCGCAAGTTGAGTTAGGCCCGGTTGATACATCTGTTGCGCTTATTCTTTGTGATTTAAAACAAAAAGATACACCGATTGTTTATGCATCTGAAGCGTTCCTTTATATGACAGGCTATAGCAATGCTGAAGTGCTTGGCAGAAACTGCCGCTTTCTTCAAAGCCCGGATGGCATGGTAAAGCCGAAAAGCACAAGAAAATATGTTGATAGCAACACAATCAACACAATGAGAAAAGCGATTGATAGAAATGCTGAAGTTCAAGTTGAAGTTGTAAACTTTAAAAAAAACGGCCAACGCTTTGTAAACTTCCTTACAATGATTCCGGTAAGAGATGAAACAGGAGAATACCGCTATAGCATGGGCTTCCAATGTGAAACAGAA

What host or chassis? The living system from HW1, for example E. coli, S. cerevisiae, CHO or another mammalian line, or a cell-free system. Your host drives almost every part choice that follows.

I would choose a bacterium that does not already have bioluminescent properties, so I would not have to engineer that into it. Specifically, I would use Bacillus subtilis, as it is a soil bacterium that forms biofilms. This would mean that it would be relatively well adapted to be exposed to the elements, and forming a biofilm would further allow it to persist.

Where does the product need to go? Cytoplasm, secreted, membrane, or a compartment? This decides whether you need a signal peptide or targeting sequence.

Since Luciferase is a cytoplasmic protein in V. fischerii, I would leave it as that in B. subtilis.

Part 2: Design your genetic parts

For each part you use, record in Kernel (and note in your write-up):

The part type and a short name.
Its sequence and where it came from (a Kernel part, a database, or designed).
One sentence of justification, why this part, for this host, for this product.

You do not need to hand-design a backbone from scratch; you may reuse an existing one and say what it provides.

Part 3: Assemble your construct

Now put the parts together into a single construct in Kernel.

Create a new construct in your folder and add your parts in the correct 5’→3’ order for your host (for a basic expression cassette: promoter → RBS or 5’ UTR/Kozak → CDS → terminator, plus any signal peptide or tag, in the vector backbone).
Check the assembled sequence: the reading frame is intact, the start and stop codons are where you expect, and there are no accidental internal stops.
Look at the construct map Kernel renders and confirm the parts sit in the order and orientation you intended.

Deliverable for this part: your assembled construct in Kernel, plus an exported schematic of it in your write-up, with a brief description of the design.

This construct has two cassettes: one constitutively expressing LEVI, and one expressing Luciferase as long as LEVI does not bind to the LexA408 operator. LEVI is a light sensitive protein that binds to the LexA408 operator in the presence of blue light. All parts have been codon-optimized for B. subtilis or are native to B. subtilis.

Part 4: Optimize and quality-check

Use Kernel’s design tools on your coding sequence and construct, and interpret the results rather than just running them.

Codon-optimize your CDS for your chosen host. Compare before and after: what changed, and why does codon usage matter for expression in this organism? Note any constraints you applied (e.g. avoiding certain restriction sites, GC content).

Parts were already codon optimized for B. subtilis, because it was easier to find the amino acid sequence than the nucleotide sequence, so I codon optimized when reverse translating the sequences. Codon optimization changes the 3rd amino acid in codons to match the more prevalent tRNAs in the host species. I did not apply any constraints about cut sites, GC content, etc.

Search your sequence (BLAST / sequence search) against known sequences. Is your CDS what you think it is? Is it identical to a natural gene, or novel? What is the closest match?

• LuxA: 78% identity with “Vibrio fischeri genes luxA and luxB for luciferase alpha and beta subunits.” Makes sense since codon optimization at most would change every 3rd base, and this is more than 67% identity.
• LuxB: 77% identity with “Vibrio fischeri strain emors.9.1 alpha subunit luciferase (luxA) gene, partial cds; and beta subunit luciferase (luxB) gene, complete cds”. Makes sense for the same reason as above.
• LEVI: 63% identity to synthetic constructs/other proteins containing the photosensitive VVD from N. crassa. Surprisingly, I’m not seeing anything about LexA in the results. This could be because this protein only contains the DNA binding domain of LexA, so the query coverage would be fairly small. Upon further investigation, LEVI does align to LexA in various species of bacteria if I click into the genome it aligns to and look at the specific region of alignment. This alignment has 79% identity.

Run the safety screen on your construct. Summarize what it checks for and what it reports. If it flags something, explain whether it is expected for your design and how you would respond.

No flags were detected, which is expected since B. subtilis is non-pathogenic, and none of the proteins in the construct are toxic.

Part 5: From design to build

How would you build it? Would you order it as synthetic DNA, assemble it from smaller fragments (e.g. Gibson assembly), or build it from a pool of oligos synthesized on a chip? Justify your choice given your construct’s length and complexity.

Given that the entire construct is ~8 kb, I would not be able to order it directly. I could order the backbone, then order the other parts in pieces, then Gibson assembly everything together (Gibson et al. 2009. I likely wouldn’t order each part separately, as some parts are fairly short, so depending on what Twist can synthesize, I might order the LEVI cassette as one fragment and the luciferase cassette as another.

What does synthesis constrain? Synthesis has error rates and struggles with certain sequences. Does your design contain anything hard to synthesize? How would error correction or fragment-based assembly change your approach?

Synthesis is constrained by error rates. Especially parts with repeats are difficult to synthesize. Checking with Twist, both fragments (the LEVI and Luciferase cassettes) are standard complexity. Twist is able to synthesize them, so I could use the above approach.

Although there are ways to minimize error rates to synthesize fragments longer than a few kb, such as 2.5 megabases by amplifying DNA from high fidelity microchips (Kosuri et al. 2010), this is unnecessary for my particular construct.

Prototype vs. scale. Mirroring HW1: the way you’d build one construct to test your idea may differ from how you’d produce DNA at the scale your product needs. Briefly describe both if they differ.

To test my idea, I’d carry out the assembly manually, while if I were scaling up, I would program the Opentrons to do it for me multiple times.

Part 6: What don’t you know yet?

As in Homework #1, close by naming the edges of your design. Identify the 2–3 biggest unknowns or risks in your construct. For example: Will the promoter give the right expression level? Will the protein fold and be active in this host? Will it be secreted? Is codon optimization enough, or do you need to tune it empirically?

For each, state how you would find out: the measurement, experiment, or design variant you would try next. A good answer here shows you know which decisions are still bets.

1. Speed of response to darkness: how quickly would Luciferase be expressed once the environment is dark?
   • Test this by taking measurements of luminescence at certain time points after darkness has been applied. To adjust this, I could adjust the strength of the promoter for luciferase or engineer LEVI to have a smaller binding affinity for the LexA operon so that it dissociates faster, although that risks leakiness when the environment is bright.
2. Light threshold for shutting off expression of Luciferase
   • Measure luminescence at different intensities of environmental light.