Week 3 HW: Cell-Free

Cell-Free Reaction Design, Coopetition & CAD Assembly

Section A: Compare Cell-Free Reaction Compositions

Question 1: Ion Sensitivity & Role of Glutamate Salts

Why do the concentrations of Potassium Glutamate (K-Glu) and Magnesium Glutamate (Mg-Glu₂) differ between CFPS formulations, and which ion is more sensitive?

1. Functional Roles & Concentration Differences

• Potassium Glutamate (K-Glu, typical range: 80–180 mM):
  • Role: K⁺ serves as the primary monovalent cation maintaining intracellular ionic strength, ribosomal translocation mechanics, and osmotic equilibrium in E. coli cell-free extracts.
  • Glutamate Counter-Anion: Standard chemical buffers often use chloride (Cl⁻) salts, but high chloride concentrations inhibit RNA polymerase transcription and translation initiation. Replacing Cl⁻ with the organic counter-anion glutamate (Glu⁻) mimics the natural E. coli cytoplasm, protecting transcriptional and translational machinery across a broad concentration range.
• Magnesium Glutamate (Mg-Glu₂, typical range: 4–18 mM):
  • Role: Mg²⁺ is an essential divalent cation cofactor required for stabilizing the 30S and 50S ribosomal subunit assembly, enabling aminoacyl-tRNA binding, complexing with Nucleotide Triphosphates (Mg-NTP²⁻), and driving T7 RNA Polymerase catalytic cleavage.

2. Sensitivity Comparison

• Magnesium (Mg²⁺) is substantially more sensitive than Potassium (K⁺).
• Mechanism of Sensitivity: The concentration response curve for Mg²⁺ exhibits a very narrow, bell-shaped optimal window. A deviation of just 1–2 mM away from the optimal Mg²⁺ concentration can cause a 50–90% drop in active protein yield:
  • Too Low Mg²⁺: Free Mg²⁺ is rapidly chelated by free NTPs and inorganic phosphate (P_i). De-complexed ribosomes dissociate into inactive 30S and 50S subunits, halting translation initiation.
  • Too High Mg²⁺: Excess divalent cations cause non-specific RNA secondary structure hyper-stabilization, mRNA misfolding, and inhibition of elongation kinetics.
• In contrast, K⁺ exhibits a much broader plateau tolerance (±20–30 mM), making Mg²⁺ the single most critical ionic variable to titrate when optimizing any cell-free formulation.

Question 2: PEP + NTP vs. Ribose + NMP Reaction Formulations

Explain how a PEP + NTP reaction formulation differs from a Ribose + NMP reaction formulation in terms of mechanism, cost, and reaction kinetics.

PEP + NTP System (Traditional High-Energy)
[PEP + NTPs] ──(Pyruvate Kinase)──> High Initial Titer ──(Pi Accumulation)──> Early Reaction Arrest (1-2 hrs)

Ribose + NMP System (Secondary / Low-Cost Catabolism)
[Ribose + NMPs] ──(Endogenous Glycolysis/Kinases)──> Steady NTP Recycling ──(No Pi Build-up)──> Sustained Yields (4-12+ hrs)

Question 3: Literature Formulation Comparison

Compare and contrast two published cell-free reaction compositions: PANOx-SP (Jewett & Swartz, 2004) vs. Low-Cost Design-Driven Formulation (Olsen et al., 2026 / Smith et al., 2026).

1. PANOx-SP Formulation (Jewett & Swartz, 2004)

• Focus: Maximizing volumetric protein yield (mg/mL) by mimicking the E. coli internal cytoplasm.
• Key Reagents & Concentrations:
  • Lysate: 25–33% v/v E. coli S30 extract.
  • Energy System: 33 mM Phosphoenolpyruvate (PEP) + 10 mM Oxaloacetate (OA) to activate secondary pyruvate catabolism and minimize phosphate inhibition.
  • Nucleotides: 1.2 mM ATP, 0.85 mM each of GTP, CTP, UTP.
  • Polyamines: 1.5 mM Spermidine + 1.0 mM Putrescine (stabilizes mRNA-ribosome interaction).
  • Cofactors: 0.33 mM NAD, 0.27 mM Coenzyme A, 0.17 mM Folinic Acid.
  • Salts: 130 mM Potassium Glutamate, 10 mM Magnesium Glutamate.
• Trade-off: Achieves high protein titers (~1 mg/mL sfGFP), but reagent costs exceed $500–$1,200 per Liter of reaction mix due to expensive PEP, high NTP loads, and luxury cofactors.

2. Low-Cost Design-Driven Formulation (Olsen et al., 2026 / Smith et al., 2026)

• Focus: Minimizing the cost per gram ($/g) of functional protein for scalable biomanufacturing.
• Key Reagents & Concentrations:
  • Lysate: 25% v/v high-density cell extract.
  • Energy System: Replaces PEP with low-cost secondary carbon substrates (30–100 mM Glucose, Maltodextrin, or Pyruvate), leveraging native glycolytic flux for ATP regeneration.
  • Nucleotides: Reduced NTP/NMP concentrations (0.5–0.8 mM), relying on endogenous recycling.
  • Cofactors: Omits or drastically reduces expensive exogenous CoA/Folinic acid, relying on endogenously retained cofactors inside the clarified cell extract.
  • Salts: Titrated 80–120 mM Potassium Glutamate, 6–8 mM Magnesium Glutamate matched to lower NTP chelating levels.
• Trade-off: Reduces total reaction composition cost down to $90–$120 per Liter (a 5–10× cost reduction), enabling high-throughput autonomous optimization of functional protein yield at industrial scale.

Section B: Unique Cell-Free Reaction Compositions (Coopetition Submissions)

System Rules & Budget Summary

• Total Reaction Volume: 20,000 nL (20 µL)
• Fixed Components (9,000 nL total — 45% of volume):
  • Cell Lysate: 5,000 nL (25% v/v)
  • DNA Template: 2,000 nL (~10 nM)
  • Base Buffer: 2,000 nL (1×)
• Variable Components Budget (11,000 nL budget — 55% of volume): Custom reagents + Nuclease-Free Water filler. All volumes in multiples of 25 nL.

Volumetric Budget Balance: V_total = V_fixed + V_reagents + V_water = 20,000 nL

1. Target 1: sfGFP (Superfolder GFP — Baseline Reporter)

• Protein Profile: 27 kDa, ~240 aa. Contains 2 cysteines but zero disulfide bonds. Folds rapidly and robustly under standard reducing conditions.
• Design Strategy: Low-cost, high-titer formulation utilizing secondary energy regeneration (Ribose) and optimized ion ratios (K⁺ and Mg²⁺) with 1.56 mM Spermidine to maximize fluorescence yield per dollar.

Reaction Composition (20,000 nL Total)

2. Target 2: PETase (TfCut2 Cutinase — Plastic Degrading Enzyme)

• Protein Profile: 28 kDa, ~260 aa. Thermostable cutinase from Thermobifida fusca with 1 required disulfide bond.
• Design Strategy: Secondary catabolic Ribose system with 300 mM K(Glu), 8.22 mM Mg(Glu)₂, 40 mM Ribose, and 2.5 µM DsbC helper to maximize catalytic activity while lowering variable cost per gram.

Reaction Composition (20,000 nL Total)

3. Target 3: Reteplase (Therapeutic Protease — Complex Folding)

• Protein Profile: 39 kDa, 355 aa. Truncated human tPA derivative containing 9 required disulfide bonds.
• Design Strategy: Full Oxidizing / Disulfide Bond (DSB) Formulation. Uses IAM-treated Δgor lysate (no DTT), a 4.04 mM GSSG : 1.0 mM GSH redox buffer (4:1 ratio), and 2.5 µM DsbC helper to shuffle mismatched disulfide pairings.

Redox Ratio Calculation: [GSSG] / [GSH] = 4.04 mM / 1.0 mM ≈ 4 : 1

Reaction Composition (20,000 nL Total)

4. Community Reagent Contribution & Rationale

• Proposed Reagent Addition: D-Trehalose (Category: Osmolytes & Chemical Chaperones).
• Suggested Stock Concentration: 1.0 M (Dispense volume: 400 nL for a final concentration of 20 mM).
• Rationale & Research Justification:
  • Mechanism: D-Trehalose is a non-reducing disaccharide that functions as a natural osmoprotectant and chemical chaperone. In cell-free reactions, trehalose increases liquid viscosity slightly, stabilizes protein tertiary structures, and inhibits non-specific hydrophobic aggregation during co-translational folding without suppressing ribosome translation rates.
  • Application: Adding trehalose is particularly valuable for multi-disulfide targets like Reteplase, where intermediate folding states are prone to off-pathway aggregation before DsbC can catalyze correct isomerization.
  • Literature Reference: Ohtake, S., & Wang, Y. J. (2011). Trehalose: Current use and future applications. Journal of Pharmaceutical Sciences, 100(6), 2020–2053.

Section C: Asimov Kernel DNA Plasmids & CAD Verification

1. Environment & Construct Specifications

• User Repository: 2026-b-mohammad-aazim
• Construct Name: pET21a_sfGFP_Expression_Vector
• Construct Length: ‘942’
• Host Framework: Standard E. coli T7 cell-free expression vector

2. Asimov Kernel Biological Part Inventory

3. Complete CDS Sequence (726 bp)

ATGAGCAAAGGCGAAGAACTGTTTACCGGCGTGGTGCCGATTCTGGTTGAACTGGATGGCGATGTGAACGGCCATAAATTCAGCGTTCGCGGCGAAGGCGAAGGCGATGCGACCATTGGCAAACTGACCCTGAAATTTATTTGCACCACCGGCAAACTGCCGGTGCCGTGGCCGACCCTGGTTACCACCCTGACCTATGGCGTGCAGTGCTTTAGCCGCTATCCGGATCACATGAAACGCCATGACTTTTTCAAAAGCGCGATGCCGGAAGGCTATGTGCAGGAACGCACCATTAGCTTCAAAGATGACGGCAAATACAAAACCCGCGCGGTGGTGAAATTTGAAGGCGATACCCTGGTTAACCGCATTGAACTGAAAGGCACCGATTTCAAAGAAGATGGCAACATTCTGGGCCATAAACTGGAATATAACTTCAACAGCCATAACGTGTATATTACCGCGGATAAACAGAAAAACGGCATCAAAGCGAACTTTACCGTTCGCCATAACGTGGAAGATGGCAGCGTGCAGCTGGCGGATCATTATCAGCAGAACACCCCGATTGGCGATGGCCCGGTGCTGCTGCCGGATAACCATTACCTGAGCACCCAGACCGTGCTGAGCAAAGATCCGAACGAAAAAGGCACCCGCGATCACATGGTTCTGCATGAATATGTGAACGCGGCGGGCATTACCTGGAGCCATCCGCAGTTCGAAAAATGATAA

4. Structural Assembly Map

[T7_Promoter_WT (20 bp)] ──> [E_coli_RBS_Strong (32 bp)] ──> [sfGFP_CDS_optimized (726 bp)] ──> [T7_Terminator (164 bp)]

• Translation Initiation: Shine-Dalgarno sequence (AAGGAG) is positioned upstream of the ATG start codon with optimal 8 bp spacing (AAGGAGATATACCATG).
• Open Reading Frame: Frame +1 starting on ATG (position +53), translating 240 amino acids cleanly from M-S-K-G-E... to C-terminal Strep-tag II (WSHPQFEK).

Section D: AI Client & Prompts Citation

• AI Client: Gemini Notebook (NotebookLM Workbench)
• Prompts & Workflows Used:
  • “go through current homework 3 document and provide the list of requirements and resources to understand the core ideas behind adjustment of the reagents in order to design one reaction composition for each of the three proteins.”