Week 2 HW: DNA Design

Part 1: Expression target

Molecule: A tagged proinsulin precursor called His-R-IP (10.85 kDa; theoretical mass 10,848 Da). It is converted on a Ni-NTA column into the mature product, desB30-insulin (about 5.7 kDa).

Sequence: The construct is derived from human proinsulin >(UniProt P01308), with these changes (Fig. above):

• The native signal peptide is replaced by a 6×His tag followed by a GGGG flexible linker and an arginine (R13). The arginine lets trypsin remove the tag and leave the native insulin N-terminus.

• An extra Asp (D44) is inserted at the start of the C-peptide, for optional Asp-N cleavage that was not used in the study.

• Lys78 is mutated to Ala (K78A), so trypsin cleaves only at R79 and the unwanted Arg-A0-insulin intermediate is avoided. The main text says K78A while the Fig. 2 legend says K74A; I use K78A, which matches the main text, and note the discrepancy.

• Codons were varied to reduce mRNA secondary structure at translation initiation, checked with mFOLD.

Host: A cell-free system, PUREfrex® 2.1: 36 purified E. coli components, with no proteases and no disulfide-reducing activity.

• The reaction is supplemented with 8 µM DsbC, 4 mM GSH and 3 mM GSSG for disulfide formation.

• It also receives the chaperones FkpA or Skp, which were critical. 100 µM Skp gave the best monomer yield, about 35 µg/mL.

Where the product goes: There is no secretion in a cell-free reaction, so no signal peptide is used. The product is soluble in the reaction and is captured by its His tag on Ni-NTA, where it is converted on the column.

Part 2: Genetic parts

Gene sequene: ATGGGCCATCATCATCATCATCATGGCGGCGGCGGCCGCTTTGTGAACCAGCATCTGTGCGGCAGCCATCTGGTGGAAGCGCTGTATCTGGTGTGCGGCGAACGCGGCTTTTTTTATACCCCGAAAACCGATCGCCGCGAAGCGGAAGATCTGCAGGTGGGCCAGGTGGAACTGGGCGGCGGCCCGGGCGCGGGCAGCCTGCAGCCGCTGGCGCTGGAAGGCAGCCTGCAGGCGCGCGGCATTGTGGAACAGTGCTGCACCAGCATTTGCAGCCTGTATCAGCTGGAAAACTATTGCAAC